ID: 1081072773

View in Genome Browser
Species Human (GRCh38)
Location 11:38631092-38631114
Sequence GATGTCTGCAGAAGATGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081072773_1081072779 17 Left 1081072773 11:38631092-38631114 CCCTGCCATCTTCTGCAGACATC No data
Right 1081072779 11:38631132-38631154 ACATTTCTTGGCCTGTTACTGGG No data
1081072773_1081072778 16 Left 1081072773 11:38631092-38631114 CCCTGCCATCTTCTGCAGACATC No data
Right 1081072778 11:38631131-38631153 GACATTTCTTGGCCTGTTACTGG No data
1081072773_1081072781 26 Left 1081072773 11:38631092-38631114 CCCTGCCATCTTCTGCAGACATC No data
Right 1081072781 11:38631141-38631163 GGCCTGTTACTGGGCTTTGGTGG 0: 144
1: 161
2: 86
3: 68
4: 218
1081072773_1081072776 5 Left 1081072773 11:38631092-38631114 CCCTGCCATCTTCTGCAGACATC No data
Right 1081072776 11:38631120-38631142 TCCTTTTGAGAGACATTTCTTGG No data
1081072773_1081072780 23 Left 1081072773 11:38631092-38631114 CCCTGCCATCTTCTGCAGACATC No data
Right 1081072780 11:38631138-38631160 CTTGGCCTGTTACTGGGCTTTGG 0: 169
1: 171
2: 103
3: 76
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081072773 Original CRISPR GATGTCTGCAGAAGATGGCA GGG (reversed) Intergenic
No off target data available for this crispr