ID: 1081072778

View in Genome Browser
Species Human (GRCh38)
Location 11:38631131-38631153
Sequence GACATTTCTTGGCCTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081072773_1081072778 16 Left 1081072773 11:38631092-38631114 CCCTGCCATCTTCTGCAGACATC No data
Right 1081072778 11:38631131-38631153 GACATTTCTTGGCCTGTTACTGG No data
1081072775_1081072778 11 Left 1081072775 11:38631097-38631119 CCATCTTCTGCAGACATCTACTC No data
Right 1081072778 11:38631131-38631153 GACATTTCTTGGCCTGTTACTGG No data
1081072774_1081072778 15 Left 1081072774 11:38631093-38631115 CCTGCCATCTTCTGCAGACATCT No data
Right 1081072778 11:38631131-38631153 GACATTTCTTGGCCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081072778 Original CRISPR GACATTTCTTGGCCTGTTAC TGG Intergenic
No off target data available for this crispr