ID: 1081074704

View in Genome Browser
Species Human (GRCh38)
Location 11:38656538-38656560
Sequence TACTCTCTACACTCTAGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081074703_1081074704 0 Left 1081074703 11:38656515-38656537 CCAAATGTCATTTCTGCAGCAAA No data
Right 1081074704 11:38656538-38656560 TACTCTCTACACTCTAGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081074704 Original CRISPR TACTCTCTACACTCTAGAGT AGG Intergenic
No off target data available for this crispr