ID: 1081075482

View in Genome Browser
Species Human (GRCh38)
Location 11:38667900-38667922
Sequence GACACTGAGGGGAATTCAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081075482_1081075490 30 Left 1081075482 11:38667900-38667922 CCGGCTGAATTCCCCTCAGTGTC No data
Right 1081075490 11:38667953-38667975 CCGCTTTTTTCCACCATTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081075482 Original CRISPR GACACTGAGGGGAATTCAGC CGG (reversed) Intergenic
No off target data available for this crispr