ID: 1081076786

View in Genome Browser
Species Human (GRCh38)
Location 11:38685017-38685039
Sequence AACAGATTGTAGGAGTAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081076786_1081076789 1 Left 1081076786 11:38685017-38685039 CCACCTTACTCCTACAATCTGTT No data
Right 1081076789 11:38685041-38685063 TTTTGTCATCTCTAAAAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081076786 Original CRISPR AACAGATTGTAGGAGTAAGG TGG (reversed) Intergenic
No off target data available for this crispr