ID: 1081077355

View in Genome Browser
Species Human (GRCh38)
Location 11:38693508-38693530
Sequence ACACATGCATTGGCTGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081077355_1081077361 12 Left 1081077355 11:38693508-38693530 CCTTGCACAGCCAATGCATGTGT No data
Right 1081077361 11:38693543-38693565 TGCCCAGTCACTGCTGAAGGGGG No data
1081077355_1081077358 9 Left 1081077355 11:38693508-38693530 CCTTGCACAGCCAATGCATGTGT No data
Right 1081077358 11:38693540-38693562 CCATGCCCAGTCACTGCTGAAGG No data
1081077355_1081077360 11 Left 1081077355 11:38693508-38693530 CCTTGCACAGCCAATGCATGTGT No data
Right 1081077360 11:38693542-38693564 ATGCCCAGTCACTGCTGAAGGGG No data
1081077355_1081077359 10 Left 1081077355 11:38693508-38693530 CCTTGCACAGCCAATGCATGTGT No data
Right 1081077359 11:38693541-38693563 CATGCCCAGTCACTGCTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081077355 Original CRISPR ACACATGCATTGGCTGTGCA AGG (reversed) Intergenic
No off target data available for this crispr