ID: 1081078180

View in Genome Browser
Species Human (GRCh38)
Location 11:38702516-38702538
Sequence TTAAATATACAAATGGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081078177_1081078180 22 Left 1081078177 11:38702471-38702493 CCTCAGTTTCTTCATCTGTGAAG No data
Right 1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081078180 Original CRISPR TTAAATATACAAATGGACAA TGG Intergenic
No off target data available for this crispr