ID: 1081080067

View in Genome Browser
Species Human (GRCh38)
Location 11:38730740-38730762
Sequence CAGGTCCACCAATTAAATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081080062_1081080067 22 Left 1081080062 11:38730695-38730717 CCTGAAGAGTGTTTTCCAACTTA 0: 26
1: 1271
2: 6259
3: 2330
4: 1044
Right 1081080067 11:38730740-38730762 CAGGTCCACCAATTAAATGTAGG No data
1081080064_1081080067 -4 Left 1081080064 11:38730721-38730743 CCATTCTGCTCATCACTTCCAGG No data
Right 1081080067 11:38730740-38730762 CAGGTCCACCAATTAAATGTAGG No data
1081080063_1081080067 7 Left 1081080063 11:38730710-38730732 CCAACTTAGTACCATTCTGCTCA No data
Right 1081080067 11:38730740-38730762 CAGGTCCACCAATTAAATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081080067 Original CRISPR CAGGTCCACCAATTAAATGT AGG Intergenic
No off target data available for this crispr