ID: 1081095823

View in Genome Browser
Species Human (GRCh38)
Location 11:38933430-38933452
Sequence CAATATCAGAAGTTGTATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081095821_1081095823 7 Left 1081095821 11:38933400-38933422 CCTACTCATGGTTTGCACTTCTT No data
Right 1081095823 11:38933430-38933452 CAATATCAGAAGTTGTATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081095823 Original CRISPR CAATATCAGAAGTTGTATTC TGG Intergenic
No off target data available for this crispr