ID: 1081102995

View in Genome Browser
Species Human (GRCh38)
Location 11:39028550-39028572
Sequence CTGAAATAGAATGAGGTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081102993_1081102995 -4 Left 1081102993 11:39028531-39028553 CCTGAGCTGTGGTATAAAACTGA No data
Right 1081102995 11:39028550-39028572 CTGAAATAGAATGAGGTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081102995 Original CRISPR CTGAAATAGAATGAGGTGTA TGG Intergenic
No off target data available for this crispr