ID: 1081107608

View in Genome Browser
Species Human (GRCh38)
Location 11:39090393-39090415
Sequence TGAGATCAATAATAACAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081107608_1081107610 -1 Left 1081107608 11:39090393-39090415 CCAGGCTGTTATTATTGATCTCA No data
Right 1081107610 11:39090415-39090437 ACTAAGCAAGGTATTATGTTTGG No data
1081107608_1081107611 2 Left 1081107608 11:39090393-39090415 CCAGGCTGTTATTATTGATCTCA No data
Right 1081107611 11:39090418-39090440 AAGCAAGGTATTATGTTTGGTGG No data
1081107608_1081107612 10 Left 1081107608 11:39090393-39090415 CCAGGCTGTTATTATTGATCTCA No data
Right 1081107612 11:39090426-39090448 TATTATGTTTGGTGGCAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081107608 Original CRISPR TGAGATCAATAATAACAGCC TGG (reversed) Intergenic
No off target data available for this crispr