ID: 1081110475

View in Genome Browser
Species Human (GRCh38)
Location 11:39128391-39128413
Sequence AGTTATCTGCATAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081110475_1081110477 4 Left 1081110475 11:39128391-39128413 CCTGCCATCTTATGCAGATAACT No data
Right 1081110477 11:39128418-39128440 TCCTTTTGAGAGACAGCTCTTGG 0: 181
1: 197
2: 163
3: 130
4: 293
1081110475_1081110479 15 Left 1081110475 11:39128391-39128413 CCTGCCATCTTATGCAGATAACT No data
Right 1081110479 11:39128429-39128451 GACAGCTCTTGGCCTGTTACTGG 0: 162
1: 189
2: 129
3: 114
4: 178
1081110475_1081110480 16 Left 1081110475 11:39128391-39128413 CCTGCCATCTTATGCAGATAACT No data
Right 1081110480 11:39128430-39128452 ACAGCTCTTGGCCTGTTACTGGG 0: 174
1: 194
2: 145
3: 123
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081110475 Original CRISPR AGTTATCTGCATAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr