ID: 1081114659

View in Genome Browser
Species Human (GRCh38)
Location 11:39185073-39185095
Sequence TGTGGTTTGCTGGCAATCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081114659_1081114666 5 Left 1081114659 11:39185073-39185095 CCAAAGATTGCCAGCAAACCACA No data
Right 1081114666 11:39185101-39185123 CTCTGAAAGGGGGATGAAACAGG No data
1081114659_1081114665 -5 Left 1081114659 11:39185073-39185095 CCAAAGATTGCCAGCAAACCACA No data
Right 1081114665 11:39185091-39185113 CCACAAGAATCTCTGAAAGGGGG No data
1081114659_1081114662 -7 Left 1081114659 11:39185073-39185095 CCAAAGATTGCCAGCAAACCACA No data
Right 1081114662 11:39185089-39185111 AACCACAAGAATCTCTGAAAGGG No data
1081114659_1081114661 -8 Left 1081114659 11:39185073-39185095 CCAAAGATTGCCAGCAAACCACA No data
Right 1081114661 11:39185088-39185110 AAACCACAAGAATCTCTGAAAGG No data
1081114659_1081114663 -6 Left 1081114659 11:39185073-39185095 CCAAAGATTGCCAGCAAACCACA No data
Right 1081114663 11:39185090-39185112 ACCACAAGAATCTCTGAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081114659 Original CRISPR TGTGGTTTGCTGGCAATCTT TGG (reversed) Intergenic
No off target data available for this crispr