ID: 1081114666

View in Genome Browser
Species Human (GRCh38)
Location 11:39185101-39185123
Sequence CTCTGAAAGGGGGATGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081114659_1081114666 5 Left 1081114659 11:39185073-39185095 CCAAAGATTGCCAGCAAACCACA No data
Right 1081114666 11:39185101-39185123 CTCTGAAAGGGGGATGAAACAGG No data
1081114660_1081114666 -5 Left 1081114660 11:39185083-39185105 CCAGCAAACCACAAGAATCTCTG No data
Right 1081114666 11:39185101-39185123 CTCTGAAAGGGGGATGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081114666 Original CRISPR CTCTGAAAGGGGGATGAAAC AGG Intergenic
No off target data available for this crispr