ID: 1081117278

View in Genome Browser
Species Human (GRCh38)
Location 11:39219102-39219124
Sequence TGATCTCCAAATTTATAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081117278_1081117279 2 Left 1081117278 11:39219102-39219124 CCAGGCTATAAATTTGGAGATCA No data
Right 1081117279 11:39219127-39219149 TATTTGTAGCTAAACCTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081117278 Original CRISPR TGATCTCCAAATTTATAGCC TGG (reversed) Intergenic
No off target data available for this crispr