ID: 1081122690

View in Genome Browser
Species Human (GRCh38)
Location 11:39285944-39285966
Sequence ACTTGGTGCCCTGTATGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081122690_1081122697 2 Left 1081122690 11:39285944-39285966 CCCTGACATACAGGGCACCAAGT No data
Right 1081122697 11:39285969-39285991 CAAGGAGGCACAAAGCAGCAAGG No data
1081122690_1081122698 8 Left 1081122690 11:39285944-39285966 CCCTGACATACAGGGCACCAAGT No data
Right 1081122698 11:39285975-39285997 GGCACAAAGCAGCAAGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081122690 Original CRISPR ACTTGGTGCCCTGTATGTCA GGG (reversed) Intergenic
No off target data available for this crispr