ID: 1081122757

View in Genome Browser
Species Human (GRCh38)
Location 11:39286521-39286543
Sequence CAAAATACTGATAGCGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081122757_1081122760 4 Left 1081122757 11:39286521-39286543 CCCATATCGCTATCAGTATTTTG No data
Right 1081122760 11:39286548-39286570 AAACCATTCAACGAGTCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081122757 Original CRISPR CAAAATACTGATAGCGATAT GGG (reversed) Intergenic
No off target data available for this crispr