ID: 1081126154

View in Genome Browser
Species Human (GRCh38)
Location 11:39325137-39325159
Sequence TTGGGCTACTAGAAGTGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081126154_1081126158 2 Left 1081126154 11:39325137-39325159 CCAACACACTTCTAGTAGCCCAA No data
Right 1081126158 11:39325162-39325184 ATTGAGAACTTCGGAACTCTAGG No data
1081126154_1081126159 8 Left 1081126154 11:39325137-39325159 CCAACACACTTCTAGTAGCCCAA No data
Right 1081126159 11:39325168-39325190 AACTTCGGAACTCTAGGAACAGG No data
1081126154_1081126155 -7 Left 1081126154 11:39325137-39325159 CCAACACACTTCTAGTAGCCCAA No data
Right 1081126155 11:39325153-39325175 AGCCCAAAGATTGAGAACTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081126154 Original CRISPR TTGGGCTACTAGAAGTGTGT TGG (reversed) Intergenic
No off target data available for this crispr