ID: 1081137847

View in Genome Browser
Species Human (GRCh38)
Location 11:39461264-39461286
Sequence TTATACCCACACATCGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081137844_1081137847 9 Left 1081137844 11:39461232-39461254 CCTGCCCAGAGAACAGATAGCAG No data
Right 1081137847 11:39461264-39461286 TTATACCCACACATCGAGCCTGG No data
1081137846_1081137847 4 Left 1081137846 11:39461237-39461259 CCAGAGAACAGATAGCAGTTACA No data
Right 1081137847 11:39461264-39461286 TTATACCCACACATCGAGCCTGG No data
1081137845_1081137847 5 Left 1081137845 11:39461236-39461258 CCCAGAGAACAGATAGCAGTTAC No data
Right 1081137847 11:39461264-39461286 TTATACCCACACATCGAGCCTGG No data
1081137843_1081137847 29 Left 1081137843 11:39461212-39461234 CCTGGGAGAGGAGAGCTGGTCCT No data
Right 1081137847 11:39461264-39461286 TTATACCCACACATCGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081137847 Original CRISPR TTATACCCACACATCGAGCC TGG Intergenic
No off target data available for this crispr