ID: 1081146843

View in Genome Browser
Species Human (GRCh38)
Location 11:39571702-39571724
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081146841_1081146843 -9 Left 1081146841 11:39571688-39571710 CCACCTTGATCAAGGGAGTCAGT No data
Right 1081146843 11:39571702-39571724 GGAGTCAGTAAGAGAATCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081146843 Original CRISPR GGAGTCAGTAAGAGAATCCC TGG Intergenic
No off target data available for this crispr