ID: 1081155052

View in Genome Browser
Species Human (GRCh38)
Location 11:39680056-39680078
Sequence TTCCATCTGCAGAGGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081155040_1081155052 18 Left 1081155040 11:39680015-39680037 CCAAGTGCTGCTGCTCCTTCCCA No data
Right 1081155052 11:39680056-39680078 TTCCATCTGCAGAGGGTGGAGGG No data
1081155039_1081155052 23 Left 1081155039 11:39680010-39680032 CCATTCCAAGTGCTGCTGCTCCT No data
Right 1081155052 11:39680056-39680078 TTCCATCTGCAGAGGGTGGAGGG No data
1081155046_1081155052 -2 Left 1081155046 11:39680035-39680057 CCATCATGTGGGGCAGCTGCCTT No data
Right 1081155052 11:39680056-39680078 TTCCATCTGCAGAGGGTGGAGGG No data
1081155045_1081155052 -1 Left 1081155045 11:39680034-39680056 CCCATCATGTGGGGCAGCTGCCT No data
Right 1081155052 11:39680056-39680078 TTCCATCTGCAGAGGGTGGAGGG No data
1081155044_1081155052 3 Left 1081155044 11:39680030-39680052 CCTTCCCATCATGTGGGGCAGCT No data
Right 1081155052 11:39680056-39680078 TTCCATCTGCAGAGGGTGGAGGG No data
1081155038_1081155052 26 Left 1081155038 11:39680007-39680029 CCGCCATTCCAAGTGCTGCTGCT No data
Right 1081155052 11:39680056-39680078 TTCCATCTGCAGAGGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081155052 Original CRISPR TTCCATCTGCAGAGGGTGGA GGG Intergenic
No off target data available for this crispr