ID: 1081163931

View in Genome Browser
Species Human (GRCh38)
Location 11:39785805-39785827
Sequence CAGGATCACCAGCTGCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081163931_1081163938 17 Left 1081163931 11:39785805-39785827 CCTCTCTGCAGCTGGTGATCCTG No data
Right 1081163938 11:39785845-39785867 CCTCAATCTGTCTGACTCCAGGG No data
1081163931_1081163936 16 Left 1081163931 11:39785805-39785827 CCTCTCTGCAGCTGGTGATCCTG No data
Right 1081163936 11:39785844-39785866 TCCTCAATCTGTCTGACTCCAGG No data
1081163931_1081163939 26 Left 1081163931 11:39785805-39785827 CCTCTCTGCAGCTGGTGATCCTG No data
Right 1081163939 11:39785854-39785876 GTCTGACTCCAGGGTTTTTATGG No data
1081163931_1081163940 27 Left 1081163931 11:39785805-39785827 CCTCTCTGCAGCTGGTGATCCTG No data
Right 1081163940 11:39785855-39785877 TCTGACTCCAGGGTTTTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081163931 Original CRISPR CAGGATCACCAGCTGCAGAG AGG (reversed) Intergenic
No off target data available for this crispr