ID: 1081164291

View in Genome Browser
Species Human (GRCh38)
Location 11:39788311-39788333
Sequence ACCCTTTGCATATAAGCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081164291_1081164294 21 Left 1081164291 11:39788311-39788333 CCCTTTGCTTATATGCAAAGGGT No data
Right 1081164294 11:39788355-39788377 AAAGACTCCATTAGCTTGAGTGG No data
1081164291_1081164293 -6 Left 1081164291 11:39788311-39788333 CCCTTTGCTTATATGCAAAGGGT No data
Right 1081164293 11:39788328-39788350 AAGGGTAGAATAGTGATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081164291 Original CRISPR ACCCTTTGCATATAAGCAAA GGG (reversed) Intergenic
No off target data available for this crispr