ID: 1081164294

View in Genome Browser
Species Human (GRCh38)
Location 11:39788355-39788377
Sequence AAAGACTCCATTAGCTTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081164292_1081164294 20 Left 1081164292 11:39788312-39788334 CCTTTGCTTATATGCAAAGGGTA No data
Right 1081164294 11:39788355-39788377 AAAGACTCCATTAGCTTGAGTGG No data
1081164291_1081164294 21 Left 1081164291 11:39788311-39788333 CCCTTTGCTTATATGCAAAGGGT No data
Right 1081164294 11:39788355-39788377 AAAGACTCCATTAGCTTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081164294 Original CRISPR AAAGACTCCATTAGCTTGAG TGG Intergenic
No off target data available for this crispr