ID: 1081164296

View in Genome Browser
Species Human (GRCh38)
Location 11:39788365-39788387
Sequence TTAGCTTGAGTGGTGCTCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081164292_1081164296 30 Left 1081164292 11:39788312-39788334 CCTTTGCTTATATGCAAAGGGTA No data
Right 1081164296 11:39788365-39788387 TTAGCTTGAGTGGTGCTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081164296 Original CRISPR TTAGCTTGAGTGGTGCTCTT TGG Intergenic
No off target data available for this crispr