ID: 1081173263

View in Genome Browser
Species Human (GRCh38)
Location 11:39893929-39893951
Sequence CCACACCCCCTCCCAAGTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081173256_1081173263 -7 Left 1081173256 11:39893913-39893935 CCCACCCTAGTTCTCCCCACACC No data
Right 1081173263 11:39893929-39893951 CCACACCCCCTCCCAAGTCTAGG No data
1081173257_1081173263 -8 Left 1081173257 11:39893914-39893936 CCACCCTAGTTCTCCCCACACCC No data
Right 1081173263 11:39893929-39893951 CCACACCCCCTCCCAAGTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081173263 Original CRISPR CCACACCCCCTCCCAAGTCT AGG Intergenic
No off target data available for this crispr