ID: 1081177534

View in Genome Browser
Species Human (GRCh38)
Location 11:39947063-39947085
Sequence ACTATTCCATAGGGTTGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081177534_1081177538 12 Left 1081177534 11:39947063-39947085 CCTCAGCAACCCTATGGAATAGT No data
Right 1081177538 11:39947098-39947120 AAAAGGAAAAAAAAATCCAAAGG No data
1081177534_1081177537 -5 Left 1081177534 11:39947063-39947085 CCTCAGCAACCCTATGGAATAGT No data
Right 1081177537 11:39947081-39947103 ATAGTGACAAGTCTGTTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081177534 Original CRISPR ACTATTCCATAGGGTTGCTG AGG (reversed) Intergenic
No off target data available for this crispr