ID: 1081187108

View in Genome Browser
Species Human (GRCh38)
Location 11:40057360-40057382
Sequence TCCCAGGTATGGAAACTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081187108_1081187113 26 Left 1081187108 11:40057360-40057382 CCACCAAGTTTCCATACCTGGGA No data
Right 1081187113 11:40057409-40057431 TCAGTATTAATGTATATCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081187108 Original CRISPR TCCCAGGTATGGAAACTTGG TGG (reversed) Intergenic
No off target data available for this crispr