ID: 1081187705

View in Genome Browser
Species Human (GRCh38)
Location 11:40065075-40065097
Sequence AGGAGGCCCCAGGTATGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081187705_1081187708 -9 Left 1081187705 11:40065075-40065097 CCTCACCATACCTGGGGCCTCCT No data
Right 1081187708 11:40065089-40065111 GGGCCTCCTGAAACTCTGTATGG No data
1081187705_1081187713 4 Left 1081187705 11:40065075-40065097 CCTCACCATACCTGGGGCCTCCT No data
Right 1081187713 11:40065102-40065124 CTCTGTATGGGGTATTTAGCTGG No data
1081187705_1081187709 -8 Left 1081187705 11:40065075-40065097 CCTCACCATACCTGGGGCCTCCT No data
Right 1081187709 11:40065090-40065112 GGCCTCCTGAAACTCTGTATGGG No data
1081187705_1081187710 -7 Left 1081187705 11:40065075-40065097 CCTCACCATACCTGGGGCCTCCT No data
Right 1081187710 11:40065091-40065113 GCCTCCTGAAACTCTGTATGGGG No data
1081187705_1081187714 5 Left 1081187705 11:40065075-40065097 CCTCACCATACCTGGGGCCTCCT No data
Right 1081187714 11:40065103-40065125 TCTGTATGGGGTATTTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081187705 Original CRISPR AGGAGGCCCCAGGTATGGTG AGG (reversed) Intergenic
No off target data available for this crispr