ID: 1081187709

View in Genome Browser
Species Human (GRCh38)
Location 11:40065090-40065112
Sequence GGCCTCCTGAAACTCTGTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081187705_1081187709 -8 Left 1081187705 11:40065075-40065097 CCTCACCATACCTGGGGCCTCCT No data
Right 1081187709 11:40065090-40065112 GGCCTCCTGAAACTCTGTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081187709 Original CRISPR GGCCTCCTGAAACTCTGTAT GGG Intergenic
No off target data available for this crispr