ID: 1081193099

View in Genome Browser
Species Human (GRCh38)
Location 11:40128361-40128383
Sequence CAGACCCACATTATGTTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 1, 2: 0, 3: 11, 4: 166}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081193099 Original CRISPR CAGACCCACATTATGTTTTA AGG (reversed) Intronic
902186742 1:14731089-14731111 CAGAGCCCCATTTTGTTTTAAGG - Intronic
908517114 1:64904310-64904332 CATTCCCAAATTATGTTTTCTGG + Intronic
909421551 1:75471932-75471954 CAGACCCATAATCTGTTTTGTGG + Intronic
909701429 1:78528479-78528501 TAGACTCATATTATGCTTTAGGG + Intronic
910351580 1:86304860-86304882 CAGAAACACATGATGATTTAGGG + Intergenic
911790333 1:102006890-102006912 CAGAATCTCATTATTTTTTATGG + Intergenic
913208132 1:116560303-116560325 GAGATCCACAGTATGCTTTAGGG + Intronic
916607837 1:166360565-166360587 CATACCCACATTTTTTTTCATGG + Intergenic
917663864 1:177204838-177204860 CAGATATACATTATGTTTAATGG + Intronic
918378786 1:183934476-183934498 CACGCCCACATGATGTTTTGTGG - Intronic
918853963 1:189726857-189726879 CAGGATCTCATTATGTTTTATGG + Intergenic
919685262 1:200478554-200478576 CAGACCCACAGTCTGGGTTAGGG - Intergenic
920883499 1:209901935-209901957 CATAACTACATTTTGTTTTAGGG + Intergenic
924324042 1:242877577-242877599 CATACCCACTTTATTTCTTAAGG + Intergenic
924423518 1:243931115-243931137 CAGAGCCACTTTAACTTTTAAGG + Intergenic
1063762130 10:9091585-9091607 CAGTCCCACATAATGTATTCTGG - Intergenic
1064494305 10:15891833-15891855 GAGACACACATCCTGTTTTAAGG - Intergenic
1068323840 10:55457567-55457589 CAGACCCTTCTTATGTTTTCAGG + Intronic
1071236005 10:83649443-83649465 CAAAACAACATTATCTTTTAGGG - Intergenic
1071277999 10:84074176-84074198 AAAACCAACATTATCTTTTAGGG - Intergenic
1077092383 11:785224-785246 CAAACCCAGAATAGGTTTTACGG + Intergenic
1078051827 11:7972053-7972075 CAGAGCCACATTGTGATGTAAGG + Intronic
1080498703 11:32847798-32847820 CAGAACTTCATTATTTTTTATGG - Intronic
1081193099 11:40128361-40128383 CAGACCCACATTATGTTTTAAGG - Intronic
1081453531 11:43197481-43197503 CTGACCCACACTTTCTTTTAAGG - Intergenic
1083111214 11:60409491-60409513 CAGAATTACATTCTGTTTTATGG + Intronic
1084384410 11:68833800-68833822 AAGACTCACCTTATGTTTTTCGG + Intronic
1084469757 11:69352257-69352279 CAGACCCACAATAGGTTGGATGG + Intronic
1084488721 11:69466009-69466031 CCCACCCACATTATTTTTTGAGG - Intergenic
1085091718 11:73721786-73721808 CAGACTCAGTTTCTGTTTTAAGG - Intronic
1087485764 11:98758248-98758270 CAGGCCCTCAATATTTTTTAAGG - Intergenic
1089020095 11:115204834-115204856 CAGGCCCACATTATTATTTTTGG - Intronic
1092037817 12:5354653-5354675 CAGAGCTACATTATATTTAATGG + Intergenic
1093968704 12:25354531-25354553 TAGAGCCACATTCTGTTTTTTGG - Intergenic
1095639907 12:44475989-44476011 CAGACCCACATGATGAGTTTAGG - Intergenic
1096052820 12:48626294-48626316 CAGACCCACATTCAGTCATATGG - Intergenic
1096582452 12:52595670-52595692 CAGAATCACATTATTTTTTAAGG + Intronic
1097804718 12:63952663-63952685 CAGACACAGTTTATGTTTCATGG + Intronic
1101569326 12:105938479-105938501 CAGGTCCTCATTTTGTTTTACGG - Intergenic
1102937175 12:116907361-116907383 AAAGCCTACATTATGTTTTATGG + Intergenic
1103731489 12:123030806-123030828 CAGTGCCTCATTACGTTTTATGG - Intronic
1105811640 13:24001166-24001188 CACAGCCACATTACATTTTAAGG + Intronic
1108083542 13:46761669-46761691 CAGACACAGATTATTTTTTCAGG - Intergenic
1108999725 13:56782998-56783020 CAGCCTAACATTATGCTTTAAGG + Intergenic
1109578760 13:64298095-64298117 TAAATCCACTTTATGTTTTATGG + Intergenic
1109689944 13:65873221-65873243 CATACCCACATTCTTTTTTATGG + Intergenic
1116365158 14:44051279-44051301 CAGACAGAAATGATGTTTTATGG + Intergenic
1123176078 14:106420450-106420472 CAACACCACATCATGTTTTAAGG - Intergenic
1202947607 14_KI270726v1_random:43113-43135 CAACACCACATCATGTTTTAAGG + Intergenic
1126280112 15:46937861-46937883 TACACTCTCATTATGTTTTAGGG + Intergenic
1126463885 15:48942956-48942978 CAGACCCTCTTTAGGTATTATGG - Intronic
1127177400 15:56374872-56374894 CAGGGCCTCATTATTTTTTATGG + Intronic
1130295136 15:82641865-82641887 CAAAACCACATTATATATTAGGG + Intronic
1131716623 15:95118315-95118337 CAGAATCTCATTATTTTTTATGG - Intergenic
1134420721 16:14085666-14085688 AACACCCACATTGTGTTTGAAGG + Intronic
1136988111 16:35131436-35131458 GAGGCCCACAATATGTTATAAGG + Intergenic
1137419640 16:48320948-48320970 CAGAGCCAGACTCTGTTTTAAGG - Intronic
1138034141 16:53585870-53585892 CAGGCCCAGATGATTTTTTAGGG - Intergenic
1140119688 16:72072799-72072821 CAGAGCCAAATTATGTTAAAAGG + Intronic
1140314530 16:73882198-73882220 AAGACCCACCTCACGTTTTAAGG + Intergenic
1143356088 17:6329930-6329952 GGGACCCACATTCTGTTTTCTGG + Intergenic
1146508769 17:33427885-33427907 CAGAGCCACGGTGTGTTTTATGG - Intronic
1149420165 17:56502827-56502849 CAGCCCAAGATTCTGTTTTAAGG + Intronic
1149440997 17:56673810-56673832 AAAACCCACATTAATTTTTAAGG + Intergenic
1154437315 18:14357010-14357032 CAGCCCCTCAGTAGGTTTTAAGG - Intergenic
1156607667 18:38686707-38686729 CACACCCACATAATGTTTGGAGG + Intergenic
1160203332 18:76813051-76813073 AAGACCCGAATTATTTTTTAAGG - Intronic
1160816595 19:1038869-1038891 CAGCCCCTCAGTAGGTTTTAAGG + Exonic
1164408779 19:27979144-27979166 CAGAATCTCATTATTTTTTAAGG - Intergenic
1168157349 19:54482469-54482491 CAGAGCCTCATTTAGTTTTATGG - Intergenic
926551515 2:14307083-14307105 CAGACCCACATGATGTTTTAAGG + Intergenic
927738025 2:25540087-25540109 CAGACCTACATTCTTCTTTAGGG + Intronic
928449028 2:31361765-31361787 CAGATCCTCAATATGTTTTGAGG + Intronic
928456100 2:31423896-31423918 CATTCCCATACTATGTTTTAAGG + Intergenic
929236755 2:39613365-39613387 CATACCCACATTTTGTTTTTGGG + Intergenic
929289459 2:40172644-40172666 CTGGCCCAAATTTTGTTTTAAGG - Intronic
930623832 2:53673426-53673448 CAGCACTACATTAAGTTTTAGGG - Intronic
932097373 2:68863549-68863571 CATACACACATCATGTTATATGG + Intergenic
938398818 2:130970736-130970758 CAGACCCACATAATTTTTATTGG + Intronic
938557934 2:132442519-132442541 CAGGCCCACCTTCTGTTTCAAGG - Intronic
942298979 2:174544169-174544191 CATTCCCACATTGTGTTGTATGG + Intergenic
943916320 2:193638059-193638081 CACACACACATAATGTATTATGG + Intergenic
944011173 2:194977343-194977365 AAGACCAATATTATGATTTAGGG - Intergenic
944355896 2:198787569-198787591 CAGAACCAATCTATGTTTTATGG - Intergenic
945529564 2:210933669-210933691 CTGACCCTCATTATGTGATAGGG - Intergenic
945809056 2:214525827-214525849 CACACTCACATTGTGTTTTCAGG - Intronic
945999764 2:216471890-216471912 CTGATCAACATTATATTTTATGG - Intronic
947757474 2:232577893-232577915 CAGAAGCACATTGTTTTTTAAGG + Intronic
1168858689 20:1029201-1029223 CAGACCCCCATTATCTTTAATGG + Intergenic
1169955658 20:11099927-11099949 TAGACTAACATTATGTTCTATGG + Intergenic
1175653299 20:60747837-60747859 CACACCCACATTTTCTTTTCTGG - Intergenic
1176839737 21:13828628-13828650 CAGCCCCTCAGTAGGTTTTAAGG + Intergenic
1177460891 21:21408662-21408684 CATTCCCACAATAAGTTTTAGGG - Intronic
1179813427 21:43886770-43886792 CAGAACCTCATTCTTTTTTATGG + Intronic
949456759 3:4246910-4246932 CAAAACCAAATTATGTGTTAAGG - Intronic
952205769 3:31180764-31180786 CAGCCCCTCAGTAGGTTTTAAGG - Intergenic
953199215 3:40763179-40763201 CAGAATCACATTCTTTTTTATGG - Intergenic
955149832 3:56356128-56356150 CAGTCCCAGATTATTTTTAAGGG + Intronic
955179299 3:56651995-56652017 CAGAACTTCATTCTGTTTTATGG - Intronic
959270515 3:104203146-104203168 CAGACCCACATTATAGGTTCCGG + Intergenic
959336372 3:105070386-105070408 CAGAACCTCATTATTTTTTATGG - Intergenic
959498998 3:107084071-107084093 AAGATCCACATTATTCTTTAAGG + Intergenic
960206890 3:114912906-114912928 CAGAACCTCATTCTTTTTTAAGG + Intronic
960805448 3:121579242-121579264 CAGACCTAAGTTATTTTTTAGGG - Intronic
962086850 3:132200233-132200255 CACACCTACATAATGTGTTATGG + Intronic
962163684 3:133026401-133026423 GAGACACAGATTATGGTTTAAGG - Intergenic
962784473 3:138753878-138753900 CAGAACCACATTGATTTTTAGGG - Intronic
962895571 3:139710836-139710858 CAGAGCCAGAATAGGTTTTATGG - Intergenic
963420788 3:145058532-145058554 CAAATACACATTATGTTATATGG - Intergenic
965511826 3:169576087-169576109 CAGAGCCACATCATATTTTAGGG + Intronic
966458721 3:180149183-180149205 CAGCCCAAAATTATCTTTTAAGG + Intergenic
967555646 3:190854759-190854781 CACATCCACATTATGTCTTCAGG + Exonic
968743787 4:2346543-2346565 CAGACTCACACTATGTTGTTAGG - Intronic
969326219 4:6445821-6445843 CACACCAACATGATGTTCTAAGG + Intronic
974492060 4:62577676-62577698 CAGGCCCAGATTATCTTTTAGGG - Intergenic
974629802 4:64472357-64472379 CAGAACCTCATTATGTGTTGTGG + Intergenic
975030714 4:69611804-69611826 AAGATACACAGTATGTTTTAGGG + Intronic
975438919 4:74387548-74387570 ATGACCCACATTACTTTTTATGG + Exonic
979124440 4:116949578-116949600 CATACTCAGATTATGTTTTACGG + Intergenic
979810715 4:125032380-125032402 CAGACACAGGTTATGATTTAAGG - Intergenic
980189719 4:129508842-129508864 CTGAAACAAATTATGTTTTATGG + Intergenic
980254836 4:130365699-130365721 CAGACACAAACAATGTTTTAGGG + Intergenic
983126121 4:163952532-163952554 CAGACCCTCTTTTTGTTGTATGG - Intronic
984275307 4:177602531-177602553 CATAGCCCCATTATTTTTTATGG - Intergenic
984535276 4:180967424-180967446 CTGGCCCAAATTATGTTTTGAGG + Intergenic
985231031 4:187817843-187817865 CAGAACTTCATTCTGTTTTATGG + Intergenic
986292420 5:6410840-6410862 TAGACCCAAAATATGTTTTCAGG + Intergenic
987676094 5:21074218-21074240 CAAACCAACTTTATTTTTTAAGG + Intergenic
990654461 5:57939697-57939719 TAGAAACACATTATGATTTATGG - Intergenic
991450445 5:66745336-66745358 AAGGCCCACATTATGATGTATGG + Intronic
993172922 5:84443666-84443688 CAGAACAACATTACATTTTATGG - Intergenic
995103600 5:108347502-108347524 CAGAGCTTTATTATGTTTTATGG - Intronic
995634546 5:114171536-114171558 CAGACCCACAGTATATGTTTAGG + Intergenic
998912040 5:146970260-146970282 CAGACCAACATTATAGTTCAGGG - Intronic
998923121 5:147092819-147092841 TAGAGCCACATGATGTTTTCTGG - Intergenic
1007012400 6:38430376-38430398 CACACCCAACTTATGTTTTATGG + Intronic
1008100296 6:47383537-47383559 CAGACTCCCATTCTTTTTTATGG + Intergenic
1008228730 6:48957050-48957072 CAGACCTTCCTTATTTTTTAAGG - Intergenic
1009676055 6:66822801-66822823 CAGAGTCTCATTATTTTTTATGG - Intergenic
1009898909 6:69787350-69787372 CAGACACACAGAATGTTTCAAGG + Intronic
1011747339 6:90419026-90419048 CACACCCATCTTATGTTTGATGG + Intergenic
1012168911 6:95993246-95993268 CAGAACCTCATTCTTTTTTATGG - Intergenic
1012622905 6:101369392-101369414 CAGACCTAAAATATGGTTTAGGG - Intergenic
1013512936 6:110860122-110860144 CAGCCCCTCAGTAGGTTTTAAGG + Intronic
1014886785 6:126791519-126791541 CTTACCCACATCATGTATTAAGG - Intergenic
1014919057 6:127190930-127190952 CATAACCTCATTATGTTTAAAGG + Intronic
1015406628 6:132844914-132844936 CAGACTCAAATTATTTTTGAAGG + Intergenic
1016426976 6:143945416-143945438 GGGACCCACATTCTGTTTTCTGG + Intronic
1020267074 7:6568081-6568103 CAGTCCCACTCTATGGTTTATGG - Intergenic
1020691969 7:11366888-11366910 CATACCAACATTAATTTTTAAGG + Intergenic
1021958411 7:25849838-25849860 CAGGCCCACATGATGTTTGTTGG + Intergenic
1030951469 7:115795370-115795392 CAGTACCACAATATTTTTTAAGG + Intergenic
1031222141 7:118981413-118981435 CAGATCAACATTATAATTTATGG + Intergenic
1031380781 7:121083506-121083528 TAGAGCCAAATTATATTTTATGG + Intronic
1032024787 7:128432463-128432485 CAGAGCTACATTTTGTTCTACGG - Intergenic
1033856476 7:145567550-145567572 TAGACCAACATTAGATTTTAAGG - Intergenic
1035965132 8:4183407-4183429 GTGACCCACAGTATGTTTTATGG - Intronic
1037213615 8:16422769-16422791 AAGACCCACTCTATCTTTTATGG - Intronic
1039523167 8:38189665-38189687 AAGACCTACATTATCTTATATGG - Intronic
1040611403 8:48986554-48986576 CAGACCCACACTAGGTTACATGG + Intergenic
1040770002 8:50962337-50962359 CACACACACATAATTTTTTAAGG + Intergenic
1042032920 8:64496803-64496825 CAGACTCTCATTCTTTTTTATGG - Intergenic
1049926882 9:418128-418150 CAGAGCCACATTCTGGTTAATGG - Exonic
1049984596 9:937171-937193 CAGACCCTCATTCCTTTTTATGG + Intronic
1050032918 9:1405177-1405199 CAAACCCAGATTATGTTTGCAGG - Intergenic
1050051411 9:1605923-1605945 CATAAACACATTATGTGTTAAGG + Intergenic
1050055261 9:1646296-1646318 GAAACCCACATTATGTTTGCAGG + Intergenic
1051859991 9:21613429-21613451 CAGCCCCACACTGTCTTTTAGGG + Intergenic
1052421483 9:28248272-28248294 CAGACTCTCATTCTTTTTTATGG - Intronic
1055885714 9:81061161-81061183 CAGAATCTCATTATTTTTTATGG + Intergenic
1059845979 9:118276995-118277017 GAGACCAATATTATGTTTCAGGG - Intergenic
1186972205 X:14859916-14859938 CACACCCACATCAGGGTTTAAGG - Intronic
1193121949 X:77832429-77832451 AAAACCCTCATGATGTTTTAAGG + Intronic
1195272605 X:103246987-103247009 CAGACCTACAGAATGTTTCAAGG + Intergenic
1196216138 X:113054128-113054150 CTGAACCACATTCTTTTTTATGG - Intergenic
1197346878 X:125334772-125334794 CTGAAACACATTGTGTTTTATGG + Intergenic
1197396920 X:125938987-125939009 CAGACCCACATTTTATCCTAAGG + Intergenic
1199048771 X:143210273-143210295 CAGACCCTAATTCTTTTTTATGG - Intergenic
1199324487 X:146481321-146481343 CAGAACCTCATTCTTTTTTATGG + Intergenic