ID: 1081193601

View in Genome Browser
Species Human (GRCh38)
Location 11:40134503-40134525
Sequence CTACTGTCCACAGGCAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 118}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081193601 Original CRISPR CTACTGTCCACAGGCAAAAC TGG Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
902276194 1:15341238-15341260 CTACAGCCCACAGGCCAAATCGG - Intronic
902285436 1:15405401-15405423 ATGCTGTCCTCAGGGAAAACAGG + Intergenic
903046286 1:20566518-20566540 CTCCTGTCCACAGGCATCCCTGG + Intergenic
907287865 1:53393499-53393521 CTGCTGGCCACAGACAAAAACGG + Intergenic
907298057 1:53468251-53468273 CCTCTGCCCACAGGCAAAAAAGG - Intergenic
907391848 1:54163276-54163298 CTACTGTTCACAGGCTCAGCAGG + Intronic
909494897 1:76267369-76267391 CCACTGTCCAAAGTCAAAAGAGG + Intronic
909970492 1:81980009-81980031 ATACTCTCCACAGGGAACACAGG + Intronic
910195407 1:84634873-84634895 CTCCAGCCCACAGGCAAAAAAGG + Intronic
910923449 1:92374110-92374132 CTATGGTCCACAGGCCAAATTGG - Intronic
913984069 1:143549394-143549416 CCACTGTCCACACGGAAAATTGG - Intergenic
920301894 1:204994036-204994058 CTATTGTCCCAAGGCAAGACAGG - Intronic
922493265 1:226035866-226035888 CTGCTGCCCACAGGCAAAGAGGG - Intergenic
923034142 1:230272357-230272379 CTACAGTGCACAGGCCAAGCAGG + Intronic
923150876 1:231232240-231232262 TTACTGCCCATAGGCAATACTGG + Intronic
924387386 1:243511360-243511382 CTACTGTCGAGAGGCAAACAAGG - Intronic
924535727 1:244934131-244934153 CTACTTTCCACAGGAAATAAGGG - Intergenic
1063556850 10:7088628-7088650 CTACTACCCACAGGTAAAGCTGG + Intergenic
1066196229 10:33102836-33102858 CTGCAGTCCTCAGGCAAATCTGG + Intergenic
1067319921 10:45208361-45208383 GTACTATCCACAGGAAAAACTGG + Intergenic
1067565742 10:47335605-47335627 AGACTGTCCCCAGGCCAAACTGG + Intergenic
1067786958 10:49257292-49257314 CTACTGTTTTTAGGCAAAACTGG + Intergenic
1069452190 10:68526780-68526802 AAACTGTCTACAGCCAAAACTGG - Intronic
1073990347 10:109254850-109254872 CCACTGTGCCCAGCCAAAACTGG + Intergenic
1074727500 10:116326878-116326900 CTACTATTCACAGGCAAAACAGG - Intronic
1074943765 10:118260450-118260472 CCTCTGTCCACAGGGGAAACTGG + Intergenic
1076808949 10:132876719-132876741 CTACAGTTCACAGTGAAAACTGG + Intronic
1077852425 11:6085775-6085797 CTGCAGGCCACAGGCAACACAGG + Intergenic
1081193601 11:40134503-40134525 CTACTGTCCACAGGCAAAACTGG + Intronic
1081193730 11:40136038-40136060 TTACTGCCCATAGGCAAAATCGG + Intronic
1081651303 11:44825859-44825881 CTACTGTCTACAGGCCTTACAGG + Intronic
1085251092 11:75144532-75144554 CCACTGTCCAGAGGCTGAACTGG - Intronic
1097270379 12:57770517-57770539 CCACTGTGCCCAGGCAGAACTGG + Intronic
1100133345 12:91523196-91523218 CTTCTGTCCAAAGTCAGAACTGG - Intergenic
1102285114 12:111649678-111649700 TTGCTTTCCACAGGCAAAAATGG + Intronic
1104058268 12:125246754-125246776 CTTCTGTCCACAGGAACAAAGGG - Intronic
1109036256 13:57264899-57264921 CAAGTTTCCACAGGTAAAACAGG + Intergenic
1110295467 13:73859227-73859249 CTAAGGACCACATGCAAAACAGG + Intronic
1113292944 13:108925918-108925940 CTACTGTCCAAGGGAAACACTGG - Intronic
1113354564 13:109566267-109566289 CTACAGTCCCCAGGCAGAAGGGG + Intergenic
1114822838 14:26042290-26042312 ATATTGTCCTCAGGCAATACTGG + Intergenic
1115784559 14:36809836-36809858 CTGCAGGCCACAGGCCAAACTGG + Intronic
1118452922 14:65920202-65920224 CTAATGACCAAAGGAAAAACAGG + Intergenic
1122995742 14:105262877-105262899 CTCCTGTCCTCAGGCAATCCTGG - Intronic
1129248347 15:74293674-74293696 CTGATGCCCACAGACAAAACAGG + Intronic
1131177887 15:90221260-90221282 CTGCCCACCACAGGCAAAACGGG + Intronic
1131178519 15:90224883-90224905 CTACTGTCCACTGGGGAAGCAGG + Intronic
1137607578 16:49796803-49796825 CTGCTGTGCACAGGCACAAAAGG + Intronic
1139476201 16:67203661-67203683 CATCTGTCCACAGGTAGAACTGG - Exonic
1144826558 17:18108633-18108655 CTCCTTTCCAGAGACAAAACAGG + Intergenic
1146021936 17:29286951-29286973 CTATTGTCCACTGGAAAAACTGG + Exonic
1148505871 17:48126671-48126693 CTACAGTCCCCAGGCAGAAGTGG - Intergenic
1150149180 17:62794985-62795007 CTACTCTTCACAGCCAAAACAGG - Intronic
1153844665 18:9038458-9038480 CTCCTGTTCTCAGGAAAAACTGG + Intergenic
1156407469 18:36796709-36796731 CTACGGTCCACACGCAAAACTGG + Intronic
1162044490 19:7989362-7989384 CTACTGTCCAAAGATAAGACAGG + Intronic
1165094797 19:33404202-33404224 TAGCTGTCCCCAGGCAAAACTGG - Intronic
926706808 2:15843107-15843129 CTACCGTCCCCTAGCAAAACAGG + Intergenic
928867674 2:35936755-35936777 CTACTATCCAAATGCAAAAATGG - Intergenic
930540389 2:52698587-52698609 CTTCTGCTCACAGACAAAACAGG + Intergenic
933632601 2:84674256-84674278 CTACTGGCAAGTGGCAAAACTGG + Intronic
933847015 2:86334968-86334990 CTTCTGGCAAGAGGCAAAACTGG + Intronic
935668667 2:105536600-105536622 CAGCTGTTCACACGCAAAACAGG - Intergenic
936626752 2:114156850-114156872 CAACAGTCCACAGGGAAACCAGG - Intergenic
937124192 2:119462783-119462805 CCACTGTCCCCAGGCAGCACCGG - Intronic
937710201 2:124972013-124972035 ATGCCTTCCACAGGCAAAACTGG - Intergenic
940008878 2:149034630-149034652 CTACTCACCACAGGCAAGCCTGG - Intergenic
941304090 2:163839692-163839714 CCACTGTACACAGAAAAAACAGG - Intergenic
1170739390 20:19041642-19041664 CTAAGGACCACATGCAAAACAGG + Intergenic
1173577570 20:44123070-44123092 CCACTGTGCACAGCCAGAACAGG + Intronic
1173960956 20:47072172-47072194 CTCCTTCCCACAGGCACAACAGG + Exonic
1174647145 20:52096052-52096074 CCACTGTCCCCAGGCAAAAGTGG + Intronic
1175196954 20:57250871-57250893 CGACTGGACACAGGCAAAACAGG - Intronic
1175364141 20:58439707-58439729 CTTCTCCCCACAGGCAACACCGG - Intronic
1184053270 22:42025078-42025100 CAACTGTGCCCAGGCAAAAATGG + Intronic
949458951 3:4269683-4269705 CAACAGTCCAAAGGCAAGACAGG + Intronic
949809391 3:7989932-7989954 CTACTATCCCCAGGGAAGACAGG - Intergenic
950457551 3:13101674-13101696 ATACTGGACACAGCCAAAACAGG - Intergenic
952082262 3:29773700-29773722 TCACTGCTCACAGGCAAAACAGG - Intronic
953068752 3:39499105-39499127 CAACTCTCCACAGGCAACCCAGG - Intronic
956489713 3:69757877-69757899 CCATTTTCCACAGGCAACACTGG - Intronic
956863549 3:73347870-73347892 CTACTGTCCTCATGAAAAAAGGG - Intergenic
958424920 3:93968845-93968867 CTACTGTCCACAGGAGAAATAGG + Intronic
958904675 3:99928562-99928584 CTATTGTGCACATGCAAAATTGG - Intronic
963892731 3:150653718-150653740 TTCCTGTCCTCAGGAAAAACAGG - Intergenic
965467702 3:169052990-169053012 CTTCTTTCCCCAGGCAAATCTGG + Intergenic
967378698 3:188833549-188833571 CCTCTGTCTGCAGGCAAAACTGG + Intronic
970463767 4:16302707-16302729 CTACTGTCCACAGAAAAAGACGG - Intergenic
976407103 4:84672601-84672623 CTACTGTCATCAGGGAGAACTGG + Exonic
979417075 4:120455064-120455086 GAACTTTCCCCAGGCAAAACAGG - Intergenic
981737281 4:147966295-147966317 CTCATGTCCACAGGGAATACTGG - Intronic
984058477 4:174960862-174960884 CTCCTGTCTTCAGGGAAAACTGG - Intronic
984115181 4:175671395-175671417 CTACGGAACACAGGCAAAAGAGG + Intronic
985793465 5:1945368-1945390 CTGCCATCCACAGGCAAACCTGG - Intergenic
991407275 5:66312500-66312522 CTATTGTCCTCAGGACAAACAGG - Intergenic
993213473 5:84986792-84986814 ATTCTCTCCACACGCAAAACAGG + Intergenic
996477306 5:123936491-123936513 CTCCTTTCCACAGGCCAAGCTGG + Intergenic
997527628 5:134563589-134563611 CTTCTGGGCACAGGCAACACTGG - Intronic
1002320178 5:178370575-178370597 CTACTGTCCACAGGGCAAGGTGG + Intronic
1004713512 6:18194359-18194381 CTACTGACCACAGAAAAAGCTGG - Intronic
1004827885 6:19443411-19443433 TTTCTGTCCACAGACAAACCTGG + Intergenic
1006384457 6:33722080-33722102 CTCCTTTCCACAGGCAAAAATGG + Exonic
1006939386 6:37742001-37742023 CTACTGTGCACTGGCTACACGGG - Intergenic
1007692186 6:43709751-43709773 GTACTGGCCACAGGGACAACAGG - Intergenic
1010332751 6:74643709-74643731 CTTCTGACCAGAGGCAAAATTGG + Intergenic
1011431372 6:87290384-87290406 CTAGTGTCAGCAGGCACAACAGG - Intronic
1011713138 6:90075462-90075484 CTCCTGTCCACACTCAAACCTGG + Intronic
1012506482 6:99952089-99952111 CTAGTCTCCACAGGCACAGCAGG - Intronic
1014880362 6:126716617-126716639 ATCCTGTTAACAGGCAAAACTGG + Intergenic
1015172984 6:130275190-130275212 CTTCTGTCTACAGGAAATACAGG - Intronic
1016753625 6:147659883-147659905 TTTCTTTCCACAGGCACAACAGG - Intronic
1018776989 6:167026534-167026556 CTCCTGTTCACAGGTAAAAGGGG + Exonic
1026143678 7:67727306-67727328 CTACTGACCAAAGGCCAGACAGG + Intergenic
1028840017 7:95419237-95419259 CTCCTGCCCACAGGCAATAATGG - Intronic
1031768937 7:125818121-125818143 CTACTATGCTCAGGCAAAATAGG - Intergenic
1034085242 7:148316436-148316458 CTACTGCCCACAGTCATAATTGG + Intronic
1034648779 7:152673045-152673067 CTACTGTGCAAAGGGAAAAATGG + Intronic
1037450142 8:19008698-19008720 CTCTTGTCCACAGACCAAACAGG + Intronic
1037515777 8:19630116-19630138 CAACTGTGCACAGTCAAAGCTGG - Intronic
1042449269 8:68925393-68925415 CAAATGTCTACAGGCAAAAGAGG - Intergenic
1045649020 8:104325889-104325911 CTACTGGCAAGAGGCATAACGGG + Intergenic
1047821197 8:128522909-128522931 CAACTGGCAAGAGGCAAAACTGG - Intergenic
1050594557 9:7193049-7193071 CCACTGTGCCCAGGCAAAAATGG + Intergenic
1052999367 9:34569049-34569071 CTCCTGTTCTCAGGCAAGACTGG + Intronic
1061957939 9:133973282-133973304 CCACTCTGCACAGGAAAAACTGG + Intronic
1186701945 X:12099937-12099959 CTACTGCCCATAGCCAAATCTGG + Intergenic
1192756220 X:74049313-74049335 CTACTGCCCTCAGGCATAACAGG + Intergenic
1199668110 X:150118243-150118265 CTACTGTCCACATCTAAAATAGG - Intergenic