ID: 1081195040

View in Genome Browser
Species Human (GRCh38)
Location 11:40151011-40151033
Sequence TCTTGCAGGCATATGGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 176}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081195040_1081195043 -8 Left 1081195040 11:40151011-40151033 CCATGCTCCATATGCCTGCAAGA 0: 1
1: 0
2: 0
3: 17
4: 176
Right 1081195043 11:40151026-40151048 CTGCAAGAGTATTTGTGTCAAGG 0: 1
1: 0
2: 2
3: 34
4: 150
1081195040_1081195047 23 Left 1081195040 11:40151011-40151033 CCATGCTCCATATGCCTGCAAGA 0: 1
1: 0
2: 0
3: 17
4: 176
Right 1081195047 11:40151057-40151079 CCACCTCCCTAGCTATTCTTAGG 0: 1
1: 0
2: 1
3: 11
4: 126
1081195040_1081195044 -7 Left 1081195040 11:40151011-40151033 CCATGCTCCATATGCCTGCAAGA 0: 1
1: 0
2: 0
3: 17
4: 176
Right 1081195044 11:40151027-40151049 TGCAAGAGTATTTGTGTCAAGGG 0: 1
1: 0
2: 0
3: 12
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081195040 Original CRISPR TCTTGCAGGCATATGGAGCA TGG (reversed) Intronic
900558161 1:3290325-3290347 TCTTCCAGCCATTTTGAGCATGG - Intronic
901148422 1:7084274-7084296 TCTTGAAGACAGATGGAGGACGG + Intronic
904708183 1:32407786-32407808 TCTTGGTGGCAGTTGGAGCAAGG - Intergenic
907925708 1:58953529-58953551 TCTTCCATGCACATGGTGCAAGG - Intergenic
910515179 1:88052940-88052962 TCTAGGATGCATTTGGAGCAGGG + Intergenic
911874582 1:103143290-103143312 TCTTCCTTGCATATGGAGAAGGG - Intergenic
916090733 1:161306154-161306176 TCTTGCAGTGCTATGGAGAAGGG - Exonic
917000211 1:170349549-170349571 TCTTGCAGGTCTAGGGAGCTTGG + Intergenic
918525178 1:185456873-185456895 CCTTCCAGGCAGAGGGAGCAGGG - Intergenic
919207620 1:194437506-194437528 TCTTGCATGCTGGTGGAGCAAGG - Intergenic
920271326 1:204766679-204766701 TCTTATAGGCATGTGGAACATGG + Intergenic
920311597 1:205052023-205052045 TCTTGCAGGCAGTTGGTGAAAGG + Intronic
921507274 1:215987539-215987561 TTTTGCAGGTATGTGAAGCAAGG + Intronic
1065328116 10:24568424-24568446 TCTTGCAGGCATGGGGGTCAGGG + Intergenic
1068371445 10:56121470-56121492 TTTTGCAGGCAAATATAGCATGG + Intergenic
1068722863 10:60265735-60265757 CCTTGCTAGCATATGGAGAAAGG + Intronic
1070023197 10:72606950-72606972 TCATGAAGGCATAAGGAGCCTGG + Intronic
1070279460 10:75038072-75038094 TCTTACCTGCAGATGGAGCAGGG + Exonic
1070368121 10:75755947-75755969 TCTGGCTGGCATGTGGAGAATGG + Intronic
1070831060 10:79418399-79418421 CCTGGCAGGCAGAGGGAGCATGG - Intronic
1071727434 10:88213578-88213600 TCTGGCAGGAACAGGGAGCAGGG - Intergenic
1073760311 10:106621911-106621933 TGTTGCAGCCATTTGGAGGATGG - Intronic
1074086603 10:110212596-110212618 CTTTGCAGTCACATGGAGCAGGG + Intronic
1074619656 10:115106016-115106038 TTTTCCAGGCACATGGTGCAAGG - Intronic
1074779313 10:116789816-116789838 GCTTCCAGGGATATGAAGCATGG - Intergenic
1075144090 10:119868709-119868731 TCCTGCAGTAACATGGAGCAGGG + Intronic
1075575773 10:123576462-123576484 ACTTGGAGGCAGATAGAGCAGGG - Intergenic
1078750566 11:14158117-14158139 TCTAGCAGGCAGTTGGAGTATGG + Intronic
1079753203 11:24224479-24224501 TCTTGCATGGATATGGAGGGAGG + Intergenic
1080830548 11:35889918-35889940 TCTTAGAGGCATATGGAAAATGG - Intergenic
1081195040 11:40151011-40151033 TCTTGCAGGCATATGGAGCATGG - Intronic
1082278433 11:50246060-50246082 TTCTGGAGGCATATGGAGAAGGG - Intergenic
1083029884 11:59582681-59582703 TGTTGCTGGCATCTGAAGCAAGG + Intronic
1083273965 11:61586687-61586709 TCTTGCAGGCTTCTGGGCCAGGG - Intergenic
1085265173 11:75233491-75233513 TCTAGCAGCCATTTGGACCATGG + Intergenic
1085779076 11:79392311-79392333 ACTTGGAGGCAGAGGGAGCAAGG + Intronic
1087849816 11:103015438-103015460 TCTTGCATGCATATATTGCATGG + Intergenic
1088688375 11:112304252-112304274 TGTTACAGGCATATGGGGCAGGG + Intergenic
1091816344 12:3441582-3441604 CTCTGCAGGCATGTGGAGCACGG - Intronic
1092936635 12:13369928-13369950 CCTTGCAGGCTTCTGGAGCTGGG + Intergenic
1099565071 12:84231732-84231754 TCTTGGAGGGAGGTGGAGCAAGG - Intergenic
1100744565 12:97631700-97631722 TCCTGCAGGCAAAGGGTGCAAGG - Intergenic
1100971997 12:100080222-100080244 TTTTCCAGGCACATGGTGCAAGG - Intronic
1101632531 12:106509459-106509481 GCTTGCAGGCATACGGAATACGG - Exonic
1102181977 12:110919686-110919708 TTTTGCTGCCATTTGGAGCAAGG - Intronic
1102747946 12:115266422-115266444 TATTGCAGGCCCATGGTGCATGG + Intergenic
1104372352 12:128235060-128235082 TCTTGCAGGCTTAAGCGGCAGGG + Intergenic
1104392568 12:128403305-128403327 TCCTTGAGGCATATGGAGAAAGG + Intronic
1104681211 12:130753155-130753177 TCCTGCAGGCCTGCGGAGCATGG - Intergenic
1105440818 13:20414540-20414562 ACTTGCAGGCATGTGAAGCCTGG - Intronic
1105900960 13:24752792-24752814 TCTGGCTGTCATCTGGAGCAGGG - Intergenic
1106117424 13:26829642-26829664 TCCTGCAGGCAGATGGTGGAGGG + Intergenic
1107149598 13:37096171-37096193 TCTAGCAGGCCTCTGAAGCATGG - Intergenic
1107211103 13:37855068-37855090 TCTTGTAGGCAAATAGAACATGG - Intronic
1107604357 13:42042981-42043003 CCTTTCAGGCATTTGGAGCAAGG + Intronic
1108707254 13:53000860-53000882 TCTGGCCTGCAGATGGAGCAAGG + Intergenic
1111290350 13:86159680-86159702 TCTGGCAAGGATATGGAGAACGG - Intergenic
1112826552 13:103398515-103398537 TTTTCCAGGCACATGGTGCAAGG + Intergenic
1113630600 13:111880443-111880465 TCCTGTAGGCAGATGGAGCGGGG + Intergenic
1113630615 13:111880501-111880523 TCCCGCAGGCAGATGGAGGAGGG + Intergenic
1115126490 14:30000903-30000925 TCTTGCAGACAAATGTAGAAGGG - Intronic
1118326157 14:64782609-64782631 TCTTGCAACCATCAGGAGCAGGG - Intronic
1123941309 15:25217926-25217948 TCTTGGAGGTATGTGGAGTATGG + Intergenic
1127572203 15:60254750-60254772 TCTTGCAGGCATAGGACTCACGG + Intergenic
1128770347 15:70277226-70277248 CCCTGCAGGCACCTGGAGCAGGG + Intergenic
1129383373 15:75182010-75182032 TCATGCAGTGATTTGGAGCACGG - Intergenic
1130196088 15:81781469-81781491 TCTTCCAGGCATGTGGTTCAGGG + Intergenic
1131025528 15:89138105-89138127 GCTTCCAGGCCTGTGGAGCAGGG + Intronic
1131801662 15:96075486-96075508 TCTTGCTGTCATGTGGGGCATGG - Intergenic
1132573916 16:656169-656191 TCTTGCAGCCGTGTGGAGCCTGG + Intronic
1136283214 16:29226344-29226366 TCCTGCAGGGAGATGGAGCAGGG + Intergenic
1140963757 16:79943931-79943953 TCTTGGAGTTCTATGGAGCAGGG - Intergenic
1142087595 16:88192241-88192263 TCCTGCAGGGAGATGGAGCAGGG + Intergenic
1142170451 16:88619374-88619396 GCTTCCAGGCCCATGGAGCAAGG - Intronic
1144385543 17:14746106-14746128 TCTTGAAGGCAGCTGGAGCCTGG - Intergenic
1145839040 17:27978241-27978263 TGTTGCAGGCATCTGGGGCTGGG + Intergenic
1147402177 17:40187424-40187446 TCTTGGAAGCATGGGGAGCAGGG - Intronic
1148234884 17:45962148-45962170 TTGGGCAGGAATATGGAGCACGG + Intronic
1150562299 17:66303667-66303689 TCTAGCAGGCAAATGGCACAAGG + Intronic
1151404188 17:73876183-73876205 TGCTGCTGGCATTTGGAGCATGG + Intergenic
1151404503 17:73877894-73877916 TGCTGCTGGCATTTGGAGCATGG - Intergenic
1152449480 17:80367974-80367996 TCTCCCAGGCAGATGGAGCACGG - Exonic
1152495507 17:80668497-80668519 TCTTCCAGGCTTCTGGAGAAAGG + Intronic
1203167256 17_GL000205v2_random:108981-109003 TTTTGCAGGAAAATGGAGAAAGG - Intergenic
1155195179 18:23467505-23467527 TCTTTCATGCATATGGAGGGAGG + Exonic
1155220273 18:23678966-23678988 TCTGGCAGCCATATGGAAAATGG + Intergenic
1158334873 18:56405379-56405401 TCTTAGAGGAGTATGGAGCATGG - Intergenic
1160540909 18:79621953-79621975 TCTTGCTGGCAGCTGGAGCAGGG - Intergenic
1163134981 19:15303892-15303914 TCTTGCTGGCATCTTGATCAAGG - Intronic
1164809622 19:31145994-31146016 GCTTGCATGCCTCTGGAGCAGGG + Intergenic
1165431691 19:35776511-35776533 GGTTGCAGGGACATGGAGCAGGG + Intronic
1166770426 19:45278495-45278517 TGCTGCAGGCATCAGGAGCAGGG - Exonic
925736301 2:6967073-6967095 TCATACAGGCATATGGGGGATGG - Intronic
927102453 2:19798663-19798685 TCTTGAAGGAACATGGAGGAGGG - Intergenic
928256723 2:29729191-29729213 TCTTGCAGCCATCTGGGTCACGG + Intronic
930986610 2:57596467-57596489 TCTGGCAAGGATATGGAGAAAGG + Intergenic
932494696 2:72140575-72140597 TCTAGGAGGCATTTGGACCAAGG - Intronic
936774010 2:115950252-115950274 TCTTGCAAGCATGTGGAACTGGG - Intergenic
938380614 2:130834440-130834462 TTTTGCAAGAATATGGAGTAAGG - Intergenic
938802935 2:134779408-134779430 TTCTGCAGGCATATGGAAAATGG - Intergenic
939004491 2:136770033-136770055 TCATGCAGGCAAGTGGAACACGG - Intronic
941065208 2:160893848-160893870 TCTTGCAGCTAGATGGAGCTAGG + Intergenic
941203953 2:162548286-162548308 TCTGGCAGCCTTAGGGAGCAGGG - Intronic
943287616 2:186024505-186024527 TCTTGCAGGCAAATTTACCATGG - Intergenic
946428068 2:219610168-219610190 TCTTGGCGGCAGCTGGAGCAGGG + Intronic
1169028555 20:2390323-2390345 GTTCGCAGGCATATGGAGTATGG + Intronic
1169924030 20:10764826-10764848 TCTGGCAGGCAGATGAGGCAGGG + Intergenic
1170147371 20:13191094-13191116 GCTTGCAAGGATATGGAGAAAGG + Intergenic
1170838929 20:19908105-19908127 CCCTGCAGACAGATGGAGCATGG - Intronic
1171486845 20:25491511-25491533 TGTTACAGGCATCTGGAGCAGGG - Exonic
1173066564 20:39718685-39718707 CTTTGCAGGCACATGGAGAAGGG + Intergenic
1173288347 20:41692881-41692903 TCTTGCAGCCAAATAGAGCCGGG - Intergenic
1174841447 20:53905108-53905130 TCTTCCAGGCCTATGGAGGCAGG - Intergenic
1175761309 20:61563662-61563684 ATTTGCAGGCATGTGGAGCAGGG - Intronic
1176404502 21:6350118-6350140 TTTTGCAGGAAAATGGAGAAAGG + Intergenic
1176432655 21:6638986-6639008 TTTTGCAGGAAAATGGAGAAAGG - Intergenic
1177470893 21:21559944-21559966 TGTTGCAAGCATATGCAGCCAGG + Intergenic
1179168885 21:38957628-38957650 TCCCCCAGGCTTATGGAGCATGG + Intergenic
1179936723 21:44610705-44610727 TTTTCCAGGCACATGGTGCAAGG - Intronic
1184259949 22:43309054-43309076 TCTGGCAGGAATGAGGAGCAGGG + Intronic
1185292346 22:50033431-50033453 TCTTGCAGACATAGTGTGCATGG - Exonic
951213519 3:20001905-20001927 TCGTGCTTGCATATGGAACAGGG + Exonic
953046581 3:39298403-39298425 CACTGCAGGCATATGGAGCTGGG - Intergenic
953376664 3:42434472-42434494 TCTTTCAGGAAGATGGAACAGGG - Intergenic
954686761 3:52375229-52375251 TCTTGAAGGCACCTGGAGTAGGG - Exonic
957765698 3:84621591-84621613 TTTTGCAGGAATATGGTGCAAGG + Intergenic
958650382 3:96930269-96930291 TGTTGCAGTCATTTGGAGAAGGG + Intronic
960330616 3:116355932-116355954 TCTGGCAAGGATATGGAGAAAGG + Intronic
963308502 3:143681133-143681155 TAGTGCAGGCATCTGGAGCTTGG - Intronic
965553433 3:169994863-169994885 TCTTAAAGACATTTGGAGCATGG + Exonic
966306088 3:178536524-178536546 TCTTTCAGACATTTTGAGCAGGG + Intronic
967624097 3:191665925-191665947 TCTGGAAGGGATATGGAGAATGG + Intergenic
969460018 4:7324064-7324086 TCTTGCAGGCTTGGGGAGGAGGG + Intronic
970487019 4:16535079-16535101 TTTTCCATGCATCTGGAGCAAGG + Intronic
972695088 4:41437539-41437561 TTTTACAGGCATACGTAGCATGG + Intronic
973218654 4:47700476-47700498 TCTTTCAGGCATATTTTGCAGGG + Intronic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
978817085 4:112919219-112919241 TGTAGCAGTTATATGGAGCAGGG + Intronic
979579786 4:122343539-122343561 TATTTCATCCATATGGAGCAGGG + Exonic
982065076 4:151647335-151647357 TCTGGCAGGCAGCTAGAGCAAGG + Intronic
983743937 4:171170548-171170570 TCTTGCAGGTATTTGGAGAATGG - Intergenic
984449339 4:179878976-179878998 TCTTCCAGACAAATGGAGCTCGG + Intergenic
985663203 5:1167693-1167715 ACTTGCAGGAATTTGTAGCAGGG - Intergenic
986286411 5:6362349-6362371 TCTTTCAGACATATAGAGAAAGG - Intergenic
987027682 5:13943963-13943985 ATTTGCAGGCATATAGAACAGGG + Intronic
992946750 5:81818839-81818861 TCATGCAGGAAAATGAAGCAAGG + Intergenic
1001206140 5:169764912-169764934 TCTTCCAGGCATATGTAACATGG - Intronic
1002210170 5:177594079-177594101 TCTGGCAGGAAGATGGAGCAGGG + Intronic
1003141602 6:3476185-3476207 TCTTTCAGGCATCTGGAACAAGG - Intergenic
1006107580 6:31725682-31725704 TACTGTAGGGATATGGAGCAAGG - Intronic
1006193539 6:32223566-32223588 TCTTGCAGCCATAGGGAAGAGGG - Intronic
1006945231 6:37780125-37780147 TCCTGCAGCCATTTGGAGGAGGG - Intergenic
1007626831 6:43251522-43251544 GCTGGCAGGCATGGGGAGCAGGG - Intronic
1008368707 6:50710632-50710654 CCTTCCTGGCATGTGGAGCATGG + Intergenic
1009275742 6:61676889-61676911 TCTTGCAGACATATGTAGGTAGG + Intergenic
1010018868 6:71137056-71137078 GCTGGCAGGGATATGGAGAAAGG + Intergenic
1015888738 6:137947316-137947338 TCATGAAGGCATCTGGAGCAAGG - Intergenic
1016281149 6:142420375-142420397 TCATGAATGAATATGGAGCAAGG + Intronic
1017152387 6:151292276-151292298 TCTTTCAGTCGAATGGAGCATGG + Intronic
1017567441 6:155702702-155702724 TTTTGCAGGTATATTCAGCAGGG + Intergenic
1018724581 6:166601631-166601653 GCTTGCAGGTAAATGGAGAAAGG + Intronic
1021416604 7:20393461-20393483 TCTGGCAGCCAGATGGAGGATGG - Intronic
1023411146 7:39890499-39890521 TCTTGCAGGGAACTGCAGCATGG + Intergenic
1025093331 7:56080565-56080587 TTTTGGAGGCATATGGAGAAGGG - Exonic
1025216346 7:57060101-57060123 TTCTGGAGGCATATGGAGAAGGG - Intergenic
1025627091 7:63232544-63232566 TTCTGGAGGCATATGGAGAAGGG - Intergenic
1025655035 7:63510629-63510651 TTCTGGAGGCATATGGAGAAGGG + Intergenic
1027735055 7:81921034-81921056 TCCTGCTGGCCTGTGGAGCATGG + Intergenic
1028028534 7:85878114-85878136 TTTTGCATGTATATTGAGCAGGG - Intergenic
1031073908 7:117193988-117194010 ACTTGCAGACATAAGGAGTAGGG + Intronic
1032753867 7:134869699-134869721 TCCTGCAGGCATGTGGAGATAGG + Intronic
1035090249 7:156304510-156304532 GCTTGCAGGCCTATGGACCAGGG + Intergenic
1036405299 8:8449604-8449626 TCAAGCAGGAATATCGAGCAAGG + Intergenic
1036843293 8:12142704-12142726 TTTTGCAGGCACATGGATGAAGG - Intergenic
1037168786 8:15864507-15864529 TCTTGCAGGCCTAGAGAGAATGG + Intergenic
1038762437 8:30396693-30396715 TCTTGTAGGCAAATTGAGGAAGG - Intronic
1040456569 8:47604315-47604337 TCTTGCTGGCCTGTGCAGCATGG - Intronic
1040821463 8:51563133-51563155 TCATGAAGCCATATGGAGCCTGG + Intronic
1041644462 8:60237566-60237588 TCTTGAAGGCCTGTGGGGCAGGG - Intronic
1043403474 8:79906690-79906712 TTTTGCTGGCCTATGGGGCAGGG - Intergenic
1045065945 8:98444404-98444426 ACATGCTGGCAGATGGAGCAGGG + Intronic
1049594483 8:143477117-143477139 GCTTGCAGGCAGAGGGACCAAGG - Intronic
1051171046 9:14317642-14317664 CCTTGCAGCCATGTGGAGAATGG + Intronic
1052821969 9:33144710-33144732 TTTTGCAGGCATATGGAGTGGGG - Intronic
1056021778 9:82445500-82445522 TCTTCCAGGCCTATGGTGAAGGG - Intergenic
1056578007 9:87870626-87870648 CCTTGCAGGCACCTGGAGCTGGG + Intergenic
1203438881 Un_GL000195v1:169726-169748 TTTTGCAGGAAAATGGAGAAAGG + Intergenic
1188924869 X:36027230-36027252 TCTTACATGCATATGTTGCATGG + Intergenic
1189015019 X:37087932-37087954 TCTTGTAGGCAAATTGAGGAAGG - Intergenic
1191164161 X:57369534-57369556 CCTTGCAGGCCTAAGGAGAATGG + Intronic
1193510096 X:82388829-82388851 TCTGGCTGGCATCTGGTGCATGG + Intergenic
1196288703 X:113914299-113914321 TCTGGCAGGCACAGGGAGGAAGG + Intergenic
1196871815 X:120119867-120119889 TCTTGCAGAAATATGAGGCAGGG + Intergenic
1197431146 X:126366348-126366370 TCTTGCAGGCAAAATTAGCATGG - Intergenic