ID: 1081197981

View in Genome Browser
Species Human (GRCh38)
Location 11:40184853-40184875
Sequence CTGTCCTAAGAGGTGGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 228}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081197981_1081197984 -9 Left 1081197981 11:40184853-40184875 CCATTTTCCACCTCTTAGGACAG 0: 1
1: 0
2: 0
3: 25
4: 228
Right 1081197984 11:40184867-40184889 TTAGGACAGCTTGTGCTCACAGG 0: 1
1: 0
2: 0
3: 7
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081197981 Original CRISPR CTGTCCTAAGAGGTGGAAAA TGG (reversed) Intronic
901574213 1:10187013-10187035 CTGTTCAAAAAGGTGGAAAATGG + Intergenic
901870001 1:12132947-12132969 CTGTCCTCCCAGCTGGAAAATGG - Intronic
903193361 1:21668797-21668819 CTGTCCTCAGAGGAGGGAAGTGG - Intronic
904907762 1:33910733-33910755 CTTTCCCAAGAGGTGGCAAAGGG - Intronic
905151622 1:35931816-35931838 CTATCCTAAGAGGTAGGTAAGGG - Intronic
908087919 1:60656352-60656374 GTGGCCTAAGAAGTGAAAAAGGG - Intergenic
908342047 1:63191635-63191657 CTGTCCAAACAGATGGACAAGGG - Intergenic
908973784 1:69870756-69870778 GTGCTCTAAGAGGTGGAAAATGG - Intronic
909517644 1:76530512-76530534 CTGAGCTGAGAGATGGAAAAGGG + Intronic
909556938 1:76964429-76964451 GTGTGATAAGAGGTTGAAAAGGG - Intronic
910071454 1:83219105-83219127 CAGTTGTAACAGGTGGAAAATGG - Intergenic
910291424 1:85603561-85603583 CTGGCCGAGGAGGTGGGAAAGGG - Intergenic
913556292 1:119970508-119970530 ATGTACTAGGAGATGGAAAAAGG + Intronic
914434627 1:147648932-147648954 CTTTCCTAAGAGATGGATACTGG - Intronic
915511093 1:156387543-156387565 CAGTCCTATGAAGTGGAACAAGG - Intergenic
918404585 1:184199123-184199145 CTGTCCCTAGACATGGAAAAGGG + Intergenic
919422692 1:197390321-197390343 CTGTGCTCAGAGGAGGTAAATGG + Intronic
919509956 1:198449436-198449458 CTTACCTATGTGGTGGAAAAAGG - Intergenic
920515055 1:206579116-206579138 ATGTCCTATGCGGTGGAAAAGGG - Intronic
920968681 1:210723418-210723440 CACTCCTCAGAGGTGGAGAAGGG + Intronic
921257332 1:213354499-213354521 CTGTTATAAGAAATGGAAAATGG - Intergenic
922029224 1:221781930-221781952 CTGTCCTGAGGGGTGGAAGTCGG + Intergenic
922096598 1:222448048-222448070 TTGTCCTAATAAGTGGAAGAGGG - Intergenic
922668397 1:227491517-227491539 CTGTTCTCAGAGCAGGAAAATGG - Intergenic
922694895 1:227725039-227725061 GTGTCCTAAGAAATGTAAAATGG - Intergenic
923376985 1:233373833-233373855 CTGTACTAAGAGGCCGGAAACGG - Intronic
924243633 1:242061766-242061788 CTGTTCTCAGAGCAGGAAAAGGG + Intergenic
1062763577 10:45508-45530 CTGTTCTAAGAGCAGGAAAAGGG - Intergenic
1063645137 10:7873307-7873329 CTATTTTAAAAGGTGGAAAACGG + Intronic
1063711754 10:8486062-8486084 CTGTTCTAAGAGGTGCGTAATGG - Intergenic
1065211479 10:23407634-23407656 GGGTCCTAAGAGACGGAAAAAGG - Intergenic
1066042038 10:31558115-31558137 TTATCCTAAGAGGAGCAAAAAGG + Intergenic
1067579753 10:47435384-47435406 TTCTCCTAAGAACTGGAAAAAGG - Intergenic
1068451957 10:57202199-57202221 CTGTCATAAGAGGTTATAAAAGG - Intergenic
1069686092 10:70319832-70319854 CACTCCTAAGAGGGAGAAAAGGG - Intronic
1070279118 10:75036082-75036104 CTTTCCCAAGAGCTGGAATATGG + Intergenic
1070377016 10:75842725-75842747 TGGCCCAAAGAGGTGGAAAAGGG + Intronic
1070922349 10:80196099-80196121 CTATCCTAGGAGTTAGAAAAAGG - Intronic
1073393607 10:103199932-103199954 ATGTTCTAAGAACTGGAAAATGG - Intergenic
1074012933 10:109502599-109502621 CTGTCGGAAGATTTGGAAAAAGG + Intergenic
1074652446 10:115539589-115539611 CTGGCCCATGATGTGGAAAAGGG + Intronic
1076017483 10:127039856-127039878 CTGTCCCATTAGATGGAAAATGG + Intronic
1078157287 11:8809855-8809877 CTTTCCTAAGAGGTGGAGGAGGG - Intronic
1079659606 11:23021697-23021719 CAGTTCTCAGAGGTGGTAAAAGG + Intergenic
1080916567 11:36666319-36666341 CTGTCCCAACAGCAGGAAAACGG + Intergenic
1081197981 11:40184853-40184875 CTGTCCTAAGAGGTGGAAAATGG - Intronic
1081819829 11:45981545-45981567 CTGCCCTAATAGGAGGAAGAAGG + Intronic
1082219756 11:49620193-49620215 CAGTCCTAAGATGTTGAAAGTGG - Intergenic
1083047238 11:59747973-59747995 GTTTCCCAAGAGGTGGGAAAAGG + Intronic
1083229902 11:61310176-61310198 CTGTCCTAGGAGGAGCAGAAAGG - Intronic
1084213357 11:67633996-67634018 CTGTCCAGGCAGGTGGAAAAGGG - Intronic
1086629876 11:89004592-89004614 CAGTCCTAAGATGTTGAAAGTGG + Intronic
1087096664 11:94325750-94325772 CTAGCATAAGAGGTGGAGAAGGG + Intergenic
1088332671 11:108669754-108669776 GTGTCCTTAGATGTGGAAGAGGG + Intronic
1088814363 11:113411139-113411161 CTTTTCTAGGAGGTGGGAAAGGG - Intronic
1089309710 11:117549738-117549760 CAGTTCTAAGAAGAGGAAAATGG - Intronic
1091679067 12:2513280-2513302 CTGCCCAAAGAGGTGGAACCTGG - Intronic
1092199785 12:6573258-6573280 TTGTTCTAAGAGCTGGACAAGGG + Exonic
1092998933 12:13977656-13977678 CTGTGCTGTGAGGGGGAAAAAGG + Intronic
1094592579 12:31835455-31835477 CTTCCCTGAGAGGTGGAAGACGG + Intergenic
1096374791 12:51099775-51099797 CCATCCTAAGGGGAGGAAAAAGG + Exonic
1097307298 12:58083720-58083742 CTGTGCAGAGATGTGGAAAATGG - Intergenic
1097380303 12:58887370-58887392 CTGTCCTAAGAGAAAGAAAAGGG - Intronic
1097663708 12:62457159-62457181 CTGTCCCAAGACTTGGAATAAGG + Intergenic
1098422815 12:70321327-70321349 CTGTCCTAACAGATAGAAATTGG - Intronic
1098591343 12:72217085-72217107 CTGTCCTAAGAAGAGAAAATAGG + Intronic
1099462484 12:82940691-82940713 ATGTCATAAGGGGTGGAAAGAGG - Intronic
1100246449 12:92762660-92762682 CTGCTCTAAGAGGTGGGAAGAGG + Intronic
1101272674 12:103164074-103164096 CTGTGCTAAGATCTGTAAAATGG + Intronic
1101586050 12:106087050-106087072 CTGTCCCGCCAGGTGGAAAATGG + Intronic
1103868267 12:124071493-124071515 CTGTCCAAAGTGGTGGAAGAGGG + Intronic
1104346339 12:128002861-128002883 CTGGCCTAAGAGGTAGCAACAGG + Intergenic
1104755518 12:131266850-131266872 CTGCCCTGAGAGGTGGACACAGG + Intergenic
1106066426 13:26356120-26356142 GTGTACTAAGTGGTGGAAAGTGG + Intronic
1107051699 13:36057513-36057535 CTGCCCTAAGAGGTTTACAATGG - Intronic
1107461241 13:40605726-40605748 CTGACTAGAGAGGTGGAAAAGGG - Intronic
1108080697 13:46731887-46731909 CTGTCCTAAGGCGTTGAGAATGG - Intronic
1108843682 13:54652256-54652278 CTGTCCCAGGAGGTGCAACACGG - Intergenic
1109756276 13:66764157-66764179 ATTTCTTAAGAGGTGGAATATGG + Intronic
1111445039 13:88336130-88336152 CTTTAGAAAGAGGTGGAAAAGGG + Intergenic
1112366694 13:98761474-98761496 GTGCCATAAGAGGAGGAAAACGG + Intergenic
1112478302 13:99752217-99752239 CTGTCCTCAGAGGGCTAAAAAGG - Intronic
1115690130 14:35835307-35835329 CTGCCCAAAGATGTGGAAATAGG - Intronic
1115779349 14:36752186-36752208 CTGTCCTAATAGTGGTAAAATGG - Intronic
1115786474 14:36831816-36831838 CTGTTCTAAGAAATCGAAAATGG + Intronic
1118856258 14:69625658-69625680 CTGCCCTGGAAGGTGGAAAAAGG - Intronic
1122592160 14:102861451-102861473 CTCTCCTAAGAGAGGGATAAAGG - Intronic
1123700623 15:22912362-22912384 CTTACGTGAGAGGTGGAAAATGG - Intronic
1125362038 15:38874576-38874598 CTGGCCCTAGAGCTGGAAAATGG + Intergenic
1127406219 15:58649875-58649897 ATGTCCTAGAAGGAGGAAAATGG - Intronic
1129638013 15:77343165-77343187 CTATCCTAATAGGTGTAAAGTGG + Intronic
1131377354 15:91936726-91936748 CTGTCCTGAGAGGTGGCCAAGGG + Intronic
1131528157 15:93168799-93168821 CTATTCTAATAGGTGCAAAATGG + Intergenic
1131859664 15:96639110-96639132 CTGCCCTAAGGGAAGGAAAATGG - Intergenic
1132647029 16:1003853-1003875 CTGTCCTTAGAGGAGGGACACGG + Intergenic
1134052169 16:11144877-11144899 CTGTGCTAAGAACTGGGAAATGG + Intronic
1135333270 16:21579511-21579533 CTGTCCTAAGATTGGGAAAAAGG + Intergenic
1138058787 16:53865306-53865328 ATGTCCTCAGAGATGGCAAACGG + Intronic
1139227678 16:65248958-65248980 CTGTCATCACAGGTAGAAAAGGG + Intergenic
1141439156 16:84018160-84018182 CTGTCTTCAGAGGTGGCATAGGG + Intronic
1141637179 16:85320328-85320350 CTGGCCTCAGAGGAGGCAAACGG - Intergenic
1141741023 16:85893091-85893113 CGGTCCTTAAACGTGGAAAAGGG + Intergenic
1144095561 17:11897479-11897501 CTGTCCTATGAGGTGGCCACTGG - Intronic
1146990392 17:37265594-37265616 CTGTTCAAAGAGGAGGAAATAGG + Intronic
1149778508 17:59377712-59377734 CTGTCCTAAGAGCTTCAAATGGG - Intronic
1150224749 17:63518154-63518176 CTGTCCTGAGAGTTGGATCAAGG + Intronic
1150563633 17:66317852-66317874 CTGTCCTAAAATGTGAAAATGGG + Intronic
1152359492 17:79824789-79824811 CTTTCCTAAGAGGATTAAAATGG + Intergenic
1152956486 18:45839-45861 CTGTTCTAAGAGCAGGAAAAGGG - Intergenic
1153713116 18:7819847-7819869 ATGTCCTAAGAGGGGGACAAGGG + Intronic
1155447757 18:25929746-25929768 CTTTCCTAAGAGGTCAAACAGGG - Intergenic
1156007514 18:32461266-32461288 TTGTGCTAAGAGCTGAAAAATGG + Intronic
1156309998 18:35913062-35913084 CTGTCATAAGAGGCGCAAAGAGG + Intergenic
1157115233 18:44856282-44856304 CTGTCAGAAAAGGTGGAAAAGGG + Intronic
1157571579 18:48715907-48715929 CTGTCCCAAGATGGGGTAAAGGG + Intronic
1158271975 18:55726236-55726258 ATGTTCTAAGTGATGGAAAACGG - Intergenic
1158400190 18:57114841-57114863 CTGTCCCCAGAGGTGAGAAATGG - Intergenic
1160573467 18:79834255-79834277 CTGTCCTCCGACGTGGCAAATGG + Intergenic
1161620286 19:5293719-5293741 CTGGTCTAAGAGGGGGAAGAGGG - Intronic
1166331703 19:42081485-42081507 CAGTGCTAAGAGGTGGAAGGTGG - Exonic
1167209890 19:48127606-48127628 CTGGCCAATGAGATGGAAAAGGG + Intronic
1167481488 19:49734620-49734642 ATATCCTGGGAGGTGGAAAACGG + Intergenic
925316462 2:2930253-2930275 CACACCTAAGGGGTGGAAAAAGG - Intergenic
925781048 2:7382186-7382208 ATGTCCCAAGAGGTGCATAAGGG + Intergenic
926103796 2:10137691-10137713 CTTCCCTTGGAGGTGGAAAACGG + Intergenic
926944329 2:18170570-18170592 GTGGCCTAGGAGGTGAAAAATGG + Intronic
927784373 2:25962676-25962698 ATGTCCATAGAGGTGAAAAAAGG - Intronic
928056697 2:28063496-28063518 CTGAACTGAGAGGTGGTAAAGGG - Intronic
928740337 2:34344724-34344746 CTGGCCTATAAGGAGGAAAAAGG + Intergenic
929650529 2:43676319-43676341 CTGTCCTAACGCCTGGAAAATGG - Intronic
930537324 2:52659762-52659784 CATTCCTACGAAGTGGAAAATGG + Intergenic
931279121 2:60772766-60772788 CTGTCCTCTTAGTTGGAAAAGGG + Intronic
935719458 2:105967242-105967264 CTGTCCTAGATGGTTGAAAATGG + Intergenic
937768205 2:125686321-125686343 CAGTCCTTATAAGTGGAAAAGGG - Intergenic
938801751 2:134770346-134770368 CTGTTCTAGGAGGTCTAAAATGG + Intergenic
939152968 2:138494797-138494819 GGGTCCTCAGAGGTGGAACAAGG + Intergenic
940109508 2:150136002-150136024 CTTTCCTCATATGTGGAAAAGGG + Intergenic
941833379 2:169988137-169988159 CTTTCCTAAGAGTAGTAAAAAGG - Intronic
941918430 2:170827261-170827283 AAGTCCCAAGAGGTGCAAAAAGG - Intronic
943395627 2:187329237-187329259 CTGTCCCAAAAGGGGGAAATTGG - Intergenic
943682427 2:190782562-190782584 CTGAAGTAAGAGGAGGAAAAGGG - Intergenic
945661536 2:212691618-212691640 CTGTCCTAGAAAGTGGAAAAAGG - Intergenic
946573921 2:221053508-221053530 GTGTTCTAAGAGGGAGAAAATGG + Intergenic
948229739 2:236341357-236341379 CTCTCCTAGGAGGAGGAGAAAGG + Intronic
1169737459 20:8852448-8852470 CTGTCCCAAGAAGTGGAGGAAGG + Intronic
1170836679 20:19890513-19890535 TTGTCCTCAGAGGAGGAAGACGG + Intronic
1171483932 20:25474113-25474135 GTGTCCTTAGAGGTAGAAAGTGG + Intronic
1171882640 20:30629630-30629652 CTGTCCTGTGACGTGGAACAGGG + Intergenic
1172522788 20:35579110-35579132 CTGTCCTGGGAGGGGGAAAATGG + Intergenic
1173013071 20:39200090-39200112 CTGGCCTGACAGATGGAAAAGGG + Intergenic
1177002401 21:15630557-15630579 CTATCCTAATAGGTGTAAAATGG - Intergenic
1179053822 21:37914067-37914089 CTGTCCTCAGGGGGAGAAAAAGG - Intronic
1182758020 22:32696695-32696717 CTGTCCTGAGTGGGTGAAAACGG + Intronic
1183392052 22:37551228-37551250 CTGTTCTCAGAGGTGGAAAGAGG + Intergenic
1184135827 22:42549344-42549366 CTGCCCTAAAAAGTGGAAAAAGG - Intergenic
950161112 3:10761898-10761920 CTGACCAAAGCAGTGGAAAATGG + Intergenic
951292745 3:20893606-20893628 CTGTCCTAAGACCTAGAATAAGG + Intergenic
952781563 3:37105229-37105251 CACTCCTAAGAGATGTAAAAAGG + Intronic
954869953 3:53760260-53760282 CTGTCCTAACAGCTGGAGTAGGG - Intronic
955020010 3:55110680-55110702 CTGACCTGACAGGTGTAAAAGGG + Intergenic
956057905 3:65320191-65320213 GTGTCCTCAGAAGGGGAAAATGG + Intergenic
956365761 3:68500862-68500884 CTATCAAAAGAGGGGGAAAATGG + Intronic
957903096 3:86522652-86522674 CTGTCATGAGAGGAGCAAAAGGG - Intergenic
959190507 3:103104508-103104530 ATGTCCTTAGATGTGAAAAAAGG + Intergenic
960166542 3:114409097-114409119 ATCTTCTAAGAGGGGGAAAAAGG + Intronic
962110123 3:132436219-132436241 CTGCCAAAAGAGGGGGAAAAAGG - Intronic
963983018 3:151561450-151561472 CTGTACAAAGAGGTGTATAAAGG + Intergenic
964535387 3:157715841-157715863 GAGTCCTTATAGGTGGAAAAGGG + Intergenic
967329338 3:188275093-188275115 TGGTCTTAAGAGGTGGAAACTGG + Intronic
967350413 3:188508266-188508288 CTGTCCTAGTATGTGGCAAATGG + Intronic
967744044 3:193034971-193034993 CTCTCCTAAGAGAAGGAAATGGG - Intergenic
968357845 3:198122391-198122413 CTGTTCTAAGAGCAGGAAAAGGG + Intergenic
970379272 4:15490708-15490730 CTTTCCTTAGAGGCGGAAATTGG - Intronic
970656104 4:18231479-18231501 AGTTACTAAGAGGTGGAAAAGGG + Intergenic
970730258 4:19094831-19094853 TTCTCCTCAGAAGTGGAAAATGG - Intergenic
971877469 4:32324571-32324593 CTGCTCTAGGAGGTGGCAAATGG + Intergenic
972940072 4:44185288-44185310 CTGTCATAGGTGGTGGAAATTGG - Intronic
973542344 4:51946897-51946919 CTGTTCCAAGAGGAGGAAATTGG - Intergenic
973848213 4:54934770-54934792 CTGTCCCAAAAGGCGGAAAGTGG - Intergenic
974743659 4:66041446-66041468 TTGTGCTAAGATGTGGGAAAGGG - Intergenic
976064369 4:81166984-81167006 CTGTGTTAAGGGGTGGAGAAAGG - Intronic
978731852 4:112037231-112037253 CTGTACTAAGAGGTTTAACAGGG - Intergenic
980161750 4:129172512-129172534 TTGTCTTAATATGTGGAAAAAGG + Intergenic
981007306 4:139889169-139889191 TTCTCCTAAGAAATGGAAAAGGG - Intronic
982382906 4:154768959-154768981 CTATCATAGGAGGTGGGAAAGGG + Intergenic
983314184 4:166106552-166106574 CTGCCCTAACTGGTGGAAAAAGG + Intergenic
983806751 4:172002831-172002853 GTGTTATAAGAGGTGGAGAATGG + Intronic
985440604 4:189980683-189980705 CTGTTCTAGGAGCAGGAAAAGGG - Intergenic
987370764 5:17190891-17190913 CTCTCCTAAGATGAGGAAAAGGG - Intronic
988823800 5:34915020-34915042 CTGCGCTGAGAGGTGGAAAGGGG + Intronic
990179103 5:53140917-53140939 CTGTCCTAAGTGGTTGAAGAAGG + Intergenic
992558522 5:77927605-77927627 CTTTCCTGAGGGCTGGAAAATGG + Intergenic
992913819 5:81426749-81426771 CTGTCTTAACAGTTGGAAGAGGG - Intronic
995166227 5:109045394-109045416 CTTTCCTAAGAGAATGAAAAAGG - Intronic
996652336 5:125894665-125894687 CTGGCCTAAGTGTTGGAACAGGG - Intergenic
997767527 5:136519853-136519875 CAGTCTTAAGAGGGAGAAAAAGG - Intergenic
999091035 5:148935997-148936019 CCCTCCTCATAGGTGGAAAAGGG + Intronic
1001253433 5:170166057-170166079 CTGGAATAAGAGGTGGAAAGAGG - Intergenic
1001716889 5:173823827-173823849 CTATCCTAAGAAGTGGAGAGGGG + Intergenic
1002089780 5:176797721-176797743 CTGTCCTTTGAGGTGGGAAGTGG + Intergenic
1002434863 5:179225038-179225060 CTGTCCTTCAAGGTGGGAAAGGG - Intronic
1003333164 6:5146448-5146470 CAGTCCATAGAGCTGGAAAAGGG + Intronic
1004162555 6:13227832-13227854 CTGTGGTAAGAAGTGGAACAGGG - Exonic
1004399558 6:15275770-15275792 CTGTCCCAAGAGAAGGAAAGGGG - Intronic
1005772342 6:29086440-29086462 CAGTCCTTAGAGGTGGATGAAGG + Exonic
1007448856 6:41927788-41927810 CTCTCCCCAGAGGTGTAAAAGGG - Intronic
1012745195 6:103078107-103078129 CTGTCAAAGGAGATGGAAAATGG - Intergenic
1015131970 6:129821431-129821453 ATGTCTCAAGAGGCGGAAAAGGG - Intergenic
1016515049 6:144884025-144884047 GTGCCCTAAGAGGAGGAAATTGG + Intergenic
1022153993 7:27640613-27640635 CAGGCCCAAAAGGTGGAAAATGG - Intronic
1026271951 7:68844564-68844586 CTGTCCTGCGAGGAGGATAAAGG - Intergenic
1027123288 7:75537582-75537604 CTGCCCAAAGAGGGGGAGAATGG + Exonic
1027289163 7:76684056-76684078 CAGTTGTAACAGGTGGAAAATGG - Intergenic
1027552635 7:79618556-79618578 TTGTCCTTAGAAGTGGAAGAGGG + Intergenic
1028116462 7:87002980-87003002 CGCTCCTAAGAGGAGGAAGAAGG + Intronic
1030400985 7:109049842-109049864 ATAGCCTAAGAGGTAGAAAAAGG + Intergenic
1030970899 7:116053517-116053539 CAGTATTGAGAGGTGGAAAACGG + Intronic
1030983661 7:116214701-116214723 CTGTCCTATGAAGTAGAAATAGG + Intronic
1032406192 7:131657635-131657657 CAGTCTTATGAGGTGGCAAAAGG - Intergenic
1032780334 7:135160659-135160681 CTGTCCTAAGATGTGTAACCAGG + Intronic
1033564158 7:142562461-142562483 GTGTCCTAAAATGTGGAAGAGGG - Intergenic
1035904567 8:3495435-3495457 CTCTCATTAGGGGTGGAAAAAGG + Intronic
1036601927 8:10268911-10268933 GCGTCCCAAGAGGTGGGAAAAGG - Intronic
1036720971 8:11174932-11174954 CTGTCCTAGAAAGAGGAAAAGGG - Intronic
1038618093 8:29114494-29114516 CTGTCCTTAGGGGTGGTGAAGGG + Intronic
1039220559 8:35326018-35326040 CTGTCCTAAGAGATTAAAAATGG + Intronic
1040432677 8:47359461-47359483 CTGTCCTCAAAGGGGCAAAAAGG + Intronic
1042739406 8:72026619-72026641 CTGTGCTATCAGGTGCAAAATGG + Intronic
1044841249 8:96338879-96338901 CTGGCCTCAGAGCTGGCAAATGG + Intergenic
1045612247 8:103859350-103859372 CTCCCCAAAGTGGTGGAAAAGGG - Intronic
1047040439 8:120988720-120988742 CTGTGCAAAGACGTGAAAAATGG + Intergenic
1048256822 8:132911209-132911231 TTTTCCTCAGATGTGGAAAAGGG + Intronic
1051387756 9:16527904-16527926 CTCAGGTAAGAGGTGGAAAAAGG + Intronic
1052479075 9:28998470-28998492 GTGTTCTATGAGGGGGAAAAAGG - Intergenic
1055068653 9:72144768-72144790 CTCACCTAAGAACTGGAAAATGG + Intronic
1056977644 9:91273916-91273938 CTCTTCTCAGAGGTGGAAAAGGG + Intronic
1057690610 9:97280807-97280829 CTGGACTAAGAGTTGGAAGAGGG + Intergenic
1061403709 9:130382393-130382415 CTGTACTCAGAGGTTGAAATTGG + Intronic
1062319550 9:135984114-135984136 CTGTCCTCAGAGGAGGACAGGGG + Intergenic
1062377443 9:136268554-136268576 CTGTTCTGAGTGATGGAAAAAGG + Intergenic
1062741720 9:138178951-138178973 CTGTTCTAGGAGCAGGAAAAGGG + Intergenic
1186556018 X:10559660-10559682 CAGTCCTGAGAGATGGAGAAAGG - Intronic
1187577806 X:20576908-20576930 CTGACCTAAGAGGTAGTAAGTGG - Intergenic
1188713216 X:33428166-33428188 CTGTCCCCAGAGATGGAGAATGG - Intergenic
1192731276 X:73804794-73804816 CTGTTTTAAGAAATGGAAAAAGG + Intergenic
1193138536 X:78000474-78000496 CTGGGCTAAGAGGTTGTAAAGGG - Intronic
1195549511 X:106151160-106151182 CTGTTATAAGTGCTGGAAAATGG + Intergenic
1195713084 X:107790757-107790779 ATGTACAAATAGGTGGAAAAAGG - Intronic
1197356157 X:125439143-125439165 CTGTCCTAACAGCAGGAAAATGG - Intergenic
1197731521 X:129814288-129814310 TTGTGCTAAGGGGTAGAAAAGGG - Intronic
1199371434 X:147054472-147054494 AAGTCCTAAAAGGTGGAAGAAGG - Intergenic
1200489811 Y:3811126-3811148 ATGTCTTCAGTGGTGGAAAAGGG - Intergenic
1201758564 Y:17515301-17515323 CTGTTCTCAGAGCAGGAAAAGGG - Intergenic
1201842991 Y:18390689-18390711 CTGTTCTCAGAGCAGGAAAAGGG + Intergenic