ID: 1081198006

View in Genome Browser
Species Human (GRCh38)
Location 11:40185098-40185120
Sequence CAGTGTGAACACTTTTAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 213}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081198000_1081198006 14 Left 1081198000 11:40185061-40185083 CCTTGGTTGACAGCCAGCTGAGT 0: 1
1: 0
2: 1
3: 11
4: 159
Right 1081198006 11:40185098-40185120 CAGTGTGAACACTTTTAGGAGGG 0: 1
1: 0
2: 0
3: 13
4: 213
1081198003_1081198006 1 Left 1081198003 11:40185074-40185096 CCAGCTGAGTACAGCAATGGGAC 0: 1
1: 0
2: 0
3: 15
4: 144
Right 1081198006 11:40185098-40185120 CAGTGTGAACACTTTTAGGAGGG 0: 1
1: 0
2: 0
3: 13
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081198006 Original CRISPR CAGTGTGAACACTTTTAGGA GGG Intronic
901989544 1:13101673-13101695 CTGTGTGATCCCTCTTAGGATGG - Intergenic
901992268 1:13125079-13125101 CTGTGTGATCCCTCTTAGGATGG + Intergenic
902037492 1:13468236-13468258 CAGGGTGGACAGTTTGAGGAAGG + Intergenic
906943041 1:50272651-50272673 CAGTGTGAACAGTATAATGATGG + Intergenic
909614155 1:77587867-77587889 GAGGGTGAATACTTTTAGGTTGG + Intronic
915049260 1:153050069-153050091 CAGGGTGCATACTTTTAGGCTGG - Intergenic
917033709 1:170722870-170722892 CGGTGTGAATATTTTTAGGTAGG + Intronic
917496986 1:175549415-175549437 CAGTGTTGAGATTTTTAGGAGGG - Intronic
918434771 1:184500180-184500202 CAGCCTGGACTCTTTTAGGAAGG - Intronic
918567147 1:185948010-185948032 CAGTAGGCACACTGTTAGGATGG + Intronic
921009935 1:211131903-211131925 CACTGGGAATATTTTTAGGATGG - Intronic
921059555 1:211572252-211572274 CAGTGTTAAAACTCTTGGGAAGG - Exonic
921330868 1:214034028-214034050 CAGTGTGAAAGTCTTTAGGAGGG + Intronic
921782024 1:219175916-219175938 CAGTTTTAACACTTTTACTATGG + Intronic
921949318 1:220913306-220913328 TAGTGAGAACAGTTCTAGGAAGG + Intergenic
922173626 1:223177999-223178021 CATTCTGAACACTTTCAGGGAGG + Intergenic
922197973 1:223376183-223376205 CAGTGTAAACAGATTTAAGATGG - Intergenic
924451261 1:244181255-244181277 TAGTGAGAATACTTTTATGAAGG - Intergenic
1066563638 10:36696835-36696857 CAGTATGAAACCTTTTGGGATGG - Intergenic
1067323951 10:45248744-45248766 CAGGGAGAACAGTTTTGGGAGGG - Intergenic
1067777028 10:49171283-49171305 CAGTGTGAACAGTTCAAGGGAGG - Intronic
1068377022 10:56194114-56194136 CAGTTTAAACTATTTTAGGATGG + Intergenic
1071238739 10:83680273-83680295 GACTGTGAACACTTTTCTGATGG - Intergenic
1072979317 10:100086647-100086669 GGGTGTGGACACTTTTGGGAGGG - Intergenic
1073838607 10:107472440-107472462 CAGTGTGACCAGTTTCAGAAAGG - Intergenic
1074602832 10:114932634-114932656 CAGAGAGAACAATTTTTGGATGG - Intergenic
1077856448 11:6131088-6131110 CAATTTGAATACTTTGAGGAGGG - Intergenic
1078438460 11:11344746-11344768 CAGTGTGAGCACTATGTGGATGG + Intronic
1079985560 11:27197010-27197032 TACAGTGAACATTTTTAGGATGG + Intergenic
1081001370 11:37676870-37676892 TCCAGTGAACACTTTTAGGATGG + Intergenic
1081047831 11:38297806-38297828 CAGTGTTAGCACTTTGAGCAGGG + Intergenic
1081198006 11:40185098-40185120 CAGTGTGAACACTTTTAGGAGGG + Intronic
1081683304 11:45023885-45023907 AAGTGTGAAGACTTTGAGGCTGG - Intergenic
1082589720 11:54990942-54990964 CAGTGAGAACACTTGGAGAAAGG + Intergenic
1084233020 11:67766959-67766981 CAGTGTGCAGCCTTTTCGGATGG - Intergenic
1085301269 11:75460164-75460186 AAGTGTGACCACTTTTAGCAGGG + Intronic
1086367973 11:86127221-86127243 CTGTGAAAACACTTTTAAGAAGG + Intergenic
1088714606 11:112537822-112537844 AAGTGAGAACACTTTTGTGATGG + Intergenic
1090536368 11:127646075-127646097 AAGTGTGCACACCTTTGGGATGG + Intergenic
1091491479 12:936444-936466 CATTGTAGACAGTTTTAGGAAGG - Intronic
1091672814 12:2465378-2465400 CAGTCTGAAAAGTTTTATGAAGG + Intronic
1093102786 12:15048045-15048067 CAGTGTGACCACTGTTGGAAAGG + Intergenic
1093915965 12:24802975-24802997 CAGAGTGAATACTTCTATGATGG + Intergenic
1094194201 12:27729134-27729156 CAGTGGGAACTCTTTTAAGTTGG + Intronic
1095681262 12:44979121-44979143 CAGTGAAAACATCTTTAGGAAGG + Intergenic
1096961290 12:55580497-55580519 CTGTGTGAACACTAGTGGGAAGG + Intergenic
1098554532 12:71803808-71803830 CAGTGTGAACTTTCATAGGAAGG - Intergenic
1099032845 12:77549768-77549790 CAGTGTGCACAATTTTAAAATGG + Intergenic
1099868001 12:88308426-88308448 GAGTGTGAGCAGTTTTAGGCAGG + Intergenic
1099882788 12:88488802-88488824 CAGTATGAACATTTTCAGGCTGG - Intergenic
1101866407 12:108523630-108523652 CAGTGTTTGCTCTTTTAGGAGGG - Exonic
1103018679 12:117515984-117516006 CAGTGGGAACAATTTTGGGTTGG + Intronic
1103071323 12:117945022-117945044 AAGTGTGTACACATTTAGGATGG - Intronic
1106153355 13:27127620-27127642 CAGGTTGAAGATTTTTAGGAGGG - Intronic
1109998138 13:70157102-70157124 CGGTATGAAAACTTTTAGGAAGG - Intergenic
1110279505 13:73676372-73676394 AACTGTGAGCATTTTTAGGATGG - Intergenic
1111703879 13:91723911-91723933 CAATGAGAACAAATTTAGGAAGG - Intronic
1118832371 14:69446490-69446512 CAGTGGGAACCCTTTTAAGAGGG - Intronic
1120318046 14:82921350-82921372 GAGAGTGAACACTTTTAGTGTGG - Intergenic
1122146835 14:99695473-99695495 AGGTGTGTACACATTTAGGATGG + Intronic
1202843647 14_GL000009v2_random:147262-147284 CAATGGGATTACTTTTAGGAAGG - Intergenic
1202913047 14_GL000194v1_random:137504-137526 CAATGGGATTACTTTTAGGAAGG - Intergenic
1202879603 14_KI270722v1_random:45179-45201 CAATGGGATTACTTTTAGGAAGG + Intergenic
1123633550 15:22279350-22279372 CACTTTGTACACTTTAAGGAAGG + Intergenic
1125780186 15:42258822-42258844 TAGTGAGAACACTTTCAGAATGG + Intronic
1128675659 15:69606777-69606799 CAGTGTGGACATGTTTAGGGTGG - Intergenic
1130137996 15:81197620-81197642 CAGAGTGAACACTTTTCCCATGG - Intronic
1130650503 15:85759756-85759778 CAGTGTGAACACTGCTTGGCTGG - Exonic
1131305863 15:91242612-91242634 CAGTGTGAAGACTCTGAGGTGGG + Intronic
1132169892 15:99639971-99639993 CTTTGTAAACACTTTTATGACGG + Intronic
1133503942 16:6391812-6391834 CAGTGTGAGCTCTTCGAGGATGG - Intronic
1136119221 16:28119429-28119451 CAGTTTAAACATTTTTAGCAAGG - Intronic
1137761934 16:50948121-50948143 AAGTGTGAACACTTCCAGGTTGG + Intergenic
1138344907 16:56314726-56314748 AAATGTTAACACTGTTAGGAAGG + Intronic
1139638533 16:68274269-68274291 CAGTGAGAAGCCTTTTAGGCTGG + Intronic
1141268383 16:82517558-82517580 CAGTGTCTTCACTTTTAGAATGG - Intergenic
1141669444 16:85484166-85484188 CAGTTGGAAGACTGTTAGGATGG - Intergenic
1143117271 17:4588164-4588186 CAGTGTGAACTGTCTTAGGATGG + Intronic
1143866854 17:9929890-9929912 CTGTGAGGACACTTTGAGGAAGG - Intronic
1145184491 17:20782597-20782619 TACTGTGAACACTTTTTGGGAGG + Intergenic
1147284972 17:39395126-39395148 AAGTGTGACCACTTCTAGGCCGG + Intronic
1148411889 17:47474453-47474475 TACTGTGAACACTTTTTGGGAGG - Intergenic
1151345976 17:73501418-73501440 CAGTGTCCACACCTTGAGGAGGG + Intronic
1152998691 18:433017-433039 CAGTGTGATGATTGTTAGGAAGG + Intronic
1153398670 18:4655864-4655886 CAGTGTGTTCACTTTTAAAATGG - Intergenic
1156945335 18:42822651-42822673 CAGGATGCACAGTTTTAGGAAGG - Intronic
1159645135 18:70909502-70909524 GAGTTTGAACACTATTAGTAGGG - Intergenic
1160223716 18:76996613-76996635 CAGTATGAAACCTTTTAGAATGG - Intronic
1163189561 19:15666657-15666679 CTTTGTGAACAGTTTCAGGAAGG + Intergenic
1165567924 19:36747859-36747881 CAGTGTGAACACTCTGATGTCGG + Exonic
1168703815 19:58456773-58456795 CAGTGTTACCTCTTTGAGGATGG - Exonic
1202655222 1_KI270708v1_random:14185-14207 CAATGGGATTACTTTTAGGAAGG + Intergenic
926307790 2:11651660-11651682 CACTGTGAACCCTTGTAGTAAGG - Intergenic
926527853 2:14004945-14004967 CAGTGTTAACAATTTTAAAATGG + Intergenic
927330251 2:21854301-21854323 ATGTGTGAACACTTTTAATAAGG + Intergenic
927606004 2:24487657-24487679 CAATGTAAACATTTTTAGTAAGG + Intergenic
929330910 2:40679535-40679557 CTGTGTAAACATTTTTAGAAAGG + Intergenic
931860915 2:66353539-66353561 CAGTGTGAATTCTTGGAGGATGG - Intergenic
935271756 2:101440853-101440875 CAGTGTGCATACATTTAGGATGG + Intronic
936964122 2:118110389-118110411 ATGAGTGAAGACTTTTAGGATGG - Intronic
938176403 2:129135197-129135219 CCGTGTGGACACTTGCAGGATGG + Intergenic
939073783 2:137575818-137575840 AAGAGTAAACACTATTAGGAAGG - Intronic
941426815 2:165357045-165357067 CAGTGTTAACATTATTTGGAGGG + Intronic
942072370 2:172327559-172327581 CAGTGTGATTACTGTTGGGACGG + Intergenic
943922484 2:193726819-193726841 CAGTTTGAAGATTATTAGGAAGG - Intergenic
945126382 2:206515710-206515732 CTATGTGAACACTTTTAGACTGG + Intronic
945607267 2:211950226-211950248 CAATGTGCATACATTTAGGAAGG + Intronic
946540231 2:220676238-220676260 CTGTGTGAAGACATTTAAGAAGG + Intergenic
946783305 2:223215660-223215682 AAGTGTGAATACTTTGAGGGAGG - Intergenic
1169095806 20:2897851-2897873 CAGTGGGAACCCTTTCAGGCTGG + Intronic
1169495256 20:6109157-6109179 GACTGTCAACTCTTTTAGGATGG - Intronic
1171068903 20:22046851-22046873 GAATGTGAATACTTTTAGGATGG + Intergenic
1172943700 20:38672275-38672297 TAGTGTTCACACTTTTAAGAGGG - Intergenic
1174962685 20:55176068-55176090 AATTTTGAACACTTCTAGGAAGG - Intergenic
1176632403 21:9152176-9152198 CAATGGGATTACTTTTAGGAAGG - Intergenic
1176640906 21:9302640-9302662 CAATGGGATTACTTTTAGGAAGG + Intergenic
1177717863 21:24863524-24863546 GAGTCTGATCACTTATAGGACGG - Intergenic
1177997666 21:28121463-28121485 CAGTGAATTCACTTTTAGGATGG + Intergenic
1178671638 21:34596138-34596160 CAGTTTGCCCACTTGTAGGATGG - Intronic
1180349933 22:11792022-11792044 CAATGGGATTACTTTTAGGAAGG + Intergenic
1180374212 22:12075472-12075494 CAATGGGATTACTTTTAGGAAGG + Intergenic
1180388276 22:12200230-12200252 CAATGGGATTACTTTTAGGAAGG - Intergenic
1185139101 22:49090334-49090356 CAGTGTGGACACTTTCACGATGG - Intergenic
949095682 3:82653-82675 CAGTGTGAACTCTTCTGGGCTGG - Intergenic
949562410 3:5214743-5214765 CAGTGTCTTCTCTTTTAGGAAGG + Intronic
950250641 3:11462500-11462522 CAGCGTGAACACTTTAGGGTTGG + Intronic
950511948 3:13435032-13435054 CAGAGTGATCACGTGTAGGAAGG - Intergenic
951287261 3:20828445-20828467 CAGTGTGAATACTTTGAGTTCGG - Intergenic
951562586 3:23982857-23982879 CATTGTGAATCCTTTAAGGAAGG + Intergenic
952660580 3:35841741-35841763 CAGAGTTAACACATTTAGAAAGG + Intergenic
952747814 3:36798131-36798153 CAATGGGAACACTTGGAGGAAGG - Intergenic
954259257 3:49426855-49426877 GACTGTGAGCACCTTTAGGAAGG - Intronic
955376117 3:58398574-58398596 AAGTGAGAGCACCTTTAGGAAGG + Intronic
955424138 3:58769690-58769712 CTCTGGGAGCACTTTTAGGAGGG - Intronic
958192800 3:90204897-90204919 AATTGTGATCACTTTTATGAGGG - Intergenic
959107782 3:102084677-102084699 CAGTTTGAACACTTGTATGCCGG + Intergenic
960147906 3:114222469-114222491 AAGTATGAACAGTGTTAGGAGGG - Intergenic
962188057 3:133280948-133280970 CAGTGTGAAAGCTTTAAGGTTGG - Intronic
964047789 3:152351607-152351629 ATGTGTAAACACTTATAGGAGGG + Intronic
965306411 3:167069779-167069801 CAGAGTGAAGACTTGTATGATGG + Intergenic
965454061 3:168875436-168875458 AATTGAGAACACTTCTAGGAGGG - Intergenic
966243120 3:177776585-177776607 CAATGTCAATGCTTTTAGGAGGG + Intergenic
1202745987 3_GL000221v1_random:102383-102405 CAATGGGATTACTTTTAGGAAGG - Intergenic
969716069 4:8868774-8868796 CGGTGTGAACATTTCTCGGAAGG - Intronic
971737324 4:30471444-30471466 CAGTGTGAACTCCTTTGAGATGG - Intergenic
973749343 4:53998059-53998081 CCGTGTGAAAACATTTAGAATGG - Intronic
974602001 4:64095364-64095386 CAGTGTGAACAGTTTGAGATTGG - Intergenic
975499303 4:75067610-75067632 CAGTGTGAGCCCTTATAAGAAGG + Intergenic
976126847 4:81842334-81842356 CAGAGTGATCACTTTGACGATGG + Intronic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
976847364 4:89505163-89505185 CATTGTGACCTCTTTTAGGTTGG + Intergenic
978338568 4:107696870-107696892 CATTGTAGACACTTGTAGGATGG - Intronic
980632717 4:135456804-135456826 CACTGTGAACACCTTCAGGTGGG - Intergenic
981148724 4:141356241-141356263 CTGTGTGAACAAGTTTGGGAGGG + Intergenic
981363715 4:143876689-143876711 CAGTGTGAACAGCTCTCGGAGGG - Intronic
981374451 4:143997483-143997505 CAGTGTGAACAGCTCTAGGAGGG - Intronic
984401357 4:179269417-179269439 GAGAGTGAACAGTTCTAGGAAGG + Intergenic
1202755795 4_GL000008v2_random:60911-60933 CAATGGGATTACTTTTAGGAAGG + Intergenic
988553653 5:32218530-32218552 CAGTGTGAACGATTTTGGGCGGG + Intergenic
988898586 5:35706233-35706255 CCATGTGAATTCTTTTAGGATGG + Intronic
992709660 5:79438509-79438531 CAGTGGGATAACTTTTAGCATGG - Intronic
996610258 5:125370662-125370684 AACTGTGGACAATTTTAGGATGG - Intergenic
999813434 5:155151037-155151059 CACAGTGAACACTTTCAGTAAGG + Intergenic
1002961896 6:1923216-1923238 TAGTGTGGACACTTGAAGGATGG - Intronic
1003141526 6:3475587-3475609 CTGAGTGAACATTTTTAGTATGG + Intergenic
1003744746 6:8987831-8987853 CAGTGTGGACACTTAAAGGAGGG - Intergenic
1004767144 6:18742363-18742385 CAAAGTGAAGACTTTTAGAATGG + Intergenic
1007717168 6:43864094-43864116 GAGTGAGAACCCTCTTAGGAGGG + Intergenic
1009614331 6:65985779-65985801 CATTGTGAATATTTTTATGAAGG - Intergenic
1010160773 6:72852085-72852107 CATTTTAAACACTGTTAGGAAGG - Intronic
1012297171 6:97539330-97539352 AAGTGTTAAAACTTTTAGAATGG + Intergenic
1012835499 6:104260134-104260156 CTCTGTAAACACTTTTATGAAGG - Intergenic
1012994524 6:105960205-105960227 CAGTTTCAACATCTTTAGGATGG - Intergenic
1013857591 6:114592637-114592659 CTGTGTGAACAAGTCTAGGATGG + Intergenic
1016755008 6:147675352-147675374 CAGAGGGAACACGTTCAGGATGG - Intronic
1018243991 6:161804314-161804336 CAGTGTGGACACTGATAGGCAGG + Intronic
1020316708 7:6910572-6910594 CAGTGTGCAGCCTTTTCGGATGG - Intergenic
1022712386 7:32864115-32864137 AAGTGGGAACACTTTTAAGTGGG - Intergenic
1026003132 7:66578790-66578812 CAGTATGTAAACTTTTAAGATGG - Intergenic
1026235323 7:68521893-68521915 CAGAGTGAACGCTTTTTGGGTGG + Intergenic
1027732992 7:81899605-81899627 TACTGTGAACACTTTTACAAGGG - Intergenic
1032802910 7:135330794-135330816 CAGTGTGAGCATTTTTATGCAGG - Intergenic
1033206966 7:139431441-139431463 CAGTATGGACTCTTTTAGGCAGG + Intergenic
1035052568 7:156008787-156008809 CAGTGTGAATACTTTTTGAGTGG + Intergenic
1036001626 8:4611555-4611577 AAGTGTAAACACTTCTGGGAAGG - Intronic
1038237724 8:25777013-25777035 GACTGTAAACACTTTAAGGATGG + Intergenic
1040609081 8:48964433-48964455 CAGTAGGATTACTTTTAGGAAGG + Intergenic
1041144887 8:54864102-54864124 CAGTGTCAACACTTTCATGGTGG - Intergenic
1041587132 8:59534461-59534483 CACTGAGAGCACTTTTAGGTTGG + Intergenic
1042051717 8:64717002-64717024 AAGTGTGTACACTTTCAGCATGG + Intronic
1042230682 8:66551322-66551344 CAGTGAGAAAACTATTAGGTTGG + Intergenic
1042496651 8:69462331-69462353 CACTGTAAATAATTTTAGGAGGG - Intergenic
1045338108 8:101226585-101226607 CAGTGTAAATTCTTTTAGTAAGG + Intergenic
1045937751 8:107701716-107701738 GAGTGTAAACAGTTTTGGGAAGG - Intergenic
1046766677 8:118076624-118076646 CAGTGTGAGCACTTGTGGCAGGG - Intronic
1048544453 8:135373538-135373560 CTCTGTGTAAACTTTTAGGATGG + Intergenic
1050073793 9:1843134-1843156 CATTGTGAACAGTTTTAGTAAGG + Intergenic
1051392017 9:16575516-16575538 CAGCCTGCACACTTTTTGGATGG - Intronic
1052933071 9:34071699-34071721 CAGTGACTCCACTTTTAGGAAGG + Intergenic
1052978943 9:34433240-34433262 CATTGAGAACACTTTCAGGTTGG + Intronic
1053301112 9:36950252-36950274 CAGTGTCAATGCTTTTAAGAAGG - Intronic
1054992840 9:71349894-71349916 CAATGAGAACACTATTATGATGG - Intronic
1055476614 9:76669230-76669252 CAGTGTGATCACTGTGTGGAGGG - Intronic
1056066068 9:82936498-82936520 AATTGTGAAAACTTCTAGGACGG - Intergenic
1056331484 9:85524635-85524657 CTGTGGGAACACCTGTAGGAAGG + Intergenic
1056450957 9:86716321-86716343 GACTGTGAACTCCTTTAGGAAGG + Intergenic
1058982036 9:110179013-110179035 CATTTGGATCACTTTTAGGATGG + Intergenic
1059800833 9:117748002-117748024 CAGTGTGCGCAGTTTTAGAAGGG - Intergenic
1061511972 9:131067136-131067158 CACTGTGAGCACTGTCAGGAAGG + Exonic
1061787664 9:133040096-133040118 CAGTGTGAGCACTTTGGGAAGGG + Intronic
1062575757 9:137206703-137206725 CAGTGTGAACTCTGCCAGGATGG - Intronic
1203755231 Un_GL000218v1:119800-119822 CAATGGGATTACTTTTAGGAAGG - Intergenic
1203714609 Un_KI270742v1:132341-132363 CAATGGGATTACTTTTAGGAAGG - Intergenic
1203536599 Un_KI270743v1:45748-45770 CAATGGGATTACTTTTAGGAAGG + Intergenic
1186327984 X:8500760-8500782 TAATGTGATCACTTTTAGGAAGG + Intergenic
1186350455 X:8733739-8733761 CATTGTGAAGAGTTTCAGGATGG - Intergenic
1187714679 X:22091272-22091294 CATTCTGTCCACTTTTAGGAAGG - Intronic
1191833633 X:65441681-65441703 CAATGCGATTACTTTTAGGAAGG - Intronic
1193179048 X:78431800-78431822 CAGTGGGATCACATTTGGGATGG - Intergenic
1195722050 X:107876936-107876958 CAGGGTGAAGATTTCTAGGAGGG + Intronic
1196991542 X:121334697-121334719 CAGTTTGAACACCTCTAAGATGG - Intergenic
1201369905 Y:13252464-13252486 CAGTGTGGACGCTATTAGAATGG - Intronic
1201434039 Y:13937288-13937310 TAATGTGATCACTTTTAGGAGGG - Intergenic
1202164006 Y:21967987-21968009 CAATAGGATCACTTTTAGGAAGG - Intergenic
1202227350 Y:22618377-22618399 CAATAGGATCACTTTTAGGAAGG + Intergenic
1202315772 Y:23577277-23577299 CAATAGGATCACTTTTAGGAAGG - Intergenic
1202554993 Y:26092797-26092819 CAATAGGATCACTTTTAGGAAGG + Intergenic