ID: 1081207330

View in Genome Browser
Species Human (GRCh38)
Location 11:40291521-40291543
Sequence GGGTGGAGTTGGAGAGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 907
Summary {0: 1, 1: 0, 2: 5, 3: 92, 4: 809}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081207321_1081207330 13 Left 1081207321 11:40291485-40291507 CCTCTCTGTAATCCAAAGAAGTC 0: 1
1: 0
2: 1
3: 10
4: 130
Right 1081207330 11:40291521-40291543 GGGTGGAGTTGGAGAGAAGTAGG 0: 1
1: 0
2: 5
3: 92
4: 809
1081207322_1081207330 1 Left 1081207322 11:40291497-40291519 CCAAAGAAGTCCTCAGTTAGAAG 0: 1
1: 0
2: 1
3: 16
4: 256
Right 1081207330 11:40291521-40291543 GGGTGGAGTTGGAGAGAAGTAGG 0: 1
1: 0
2: 5
3: 92
4: 809
1081207328_1081207330 -9 Left 1081207328 11:40291507-40291529 CCTCAGTTAGAAGGGGGTGGAGT 0: 1
1: 0
2: 0
3: 17
4: 123
Right 1081207330 11:40291521-40291543 GGGTGGAGTTGGAGAGAAGTAGG 0: 1
1: 0
2: 5
3: 92
4: 809

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081207330 Original CRISPR GGGTGGAGTTGGAGAGAAGT AGG Intronic
900238362 1:1603187-1603209 TGGGGCAGTTGGAGAGAAGAGGG - Intergenic
900566656 1:3335685-3335707 GGCTGGATTTTGAAAGAAGTAGG - Intronic
900622842 1:3595294-3595316 GGGTGGAGGTGGAGGGAGGGCGG + Intronic
901327019 1:8372925-8372947 GGGGGCAGTCGGAGAGAAGGGGG + Intronic
902903108 1:19533839-19533861 GGGTCAAGTGGGAGTGAAGTGGG + Intergenic
902997801 1:20240487-20240509 GAGTGGATATGGAGAGAATTGGG + Intergenic
903241218 1:21983935-21983957 GGCTGCAGCTGGAGAGAAATGGG - Intronic
903244725 1:22007119-22007141 GGCTGCAGCTGGAGAGAAATGGG - Intronic
903537379 1:24076082-24076104 GGGTGGAGTTCAAGGGAAGTTGG - Intronic
903610611 1:24608989-24609011 GCTTGGAGTTGGAGGGAAGAAGG + Exonic
903731623 1:25500517-25500539 GGGTGGAGTTGGGGGGTAGTTGG + Intergenic
903827250 1:26155254-26155276 GGGAGGAGCGGGAGAGAAGGTGG - Intergenic
904026213 1:27505132-27505154 CTGGGGAGTTGGAGAGAACTAGG + Intergenic
904064994 1:27742595-27742617 GGGTGGGTTTGGGGAGATGTTGG + Intronic
904498260 1:30899738-30899760 GGGGGGAATTGAAGAGAAGCAGG - Intronic
904605002 1:31693221-31693243 GGGTGGAGGGGGCCAGAAGTGGG - Intronic
904724479 1:32536753-32536775 GAGTGGAGGTAGATAGAAGTGGG - Intronic
904860113 1:33530961-33530983 GGTTGGAATTGGAAAGATGTTGG + Intronic
904921849 1:34014129-34014151 CGGTGAAGGCGGAGAGAAGTGGG - Intronic
905124722 1:35708408-35708430 GGGTGGCGTTGGAGAAAGGGGGG - Intergenic
905540906 1:38759805-38759827 GGATGGAGATGGAGAGAGGATGG + Intergenic
905923460 1:41733904-41733926 GGCTGGAGGTTGAGAGGAGTGGG - Intronic
906227658 1:44134800-44134822 GAGTGGAGGTAGGGAGAAGTAGG + Exonic
906288330 1:44602952-44602974 GTGTGGACTCGGAGAGAAGGAGG - Intronic
906872296 1:49496507-49496529 GGGTGGGGTGGGTGAGATGTTGG - Intronic
907273758 1:53305734-53305756 GGGTGGAGGTGCAGGGAAGCTGG - Intronic
907461032 1:54605614-54605636 GGGTGGAGTTGGAAGGATGAAGG + Intronic
907672745 1:56491267-56491289 GGGGGGAAATGAAGAGAAGTTGG - Intergenic
907738270 1:57137798-57137820 GGTTGGTGTTAGAGAGCAGTAGG + Intronic
907901565 1:58746303-58746325 TGGTGGACATGGAGAGAAGGGGG - Intergenic
908121643 1:60991525-60991547 TGGTAGAGCTGGTGAGAAGTAGG - Intronic
908241742 1:62194499-62194521 CTGTGGAGTTGGAGAGACGCCGG + Intergenic
908462187 1:64356753-64356775 GGCTGGACCTGGAGAGAACTGGG - Intergenic
908838852 1:68257684-68257706 CAGTGGAGATGAAGAGAAGTTGG - Intergenic
910767977 1:90801518-90801540 GCCAGGAGTTGGAGAGAGGTAGG - Intergenic
911245766 1:95515405-95515427 GGGTGGGGTTAGAAAGATGTTGG - Intergenic
912386860 1:109275140-109275162 GGGTGGAGTCGGGGAGAAAGAGG - Exonic
912522489 1:110255334-110255356 GGGGTGAGCTGGAGAGAAGACGG - Intronic
912552519 1:110493359-110493381 CAGAGGAGTTGGAGAGGAGTTGG - Intergenic
912647835 1:111411729-111411751 GGGTGGAGGGTGGGAGAAGTGGG + Intergenic
912775990 1:112506878-112506900 GGCTGGAGTTGGATGGGAGTTGG - Intronic
913203314 1:116513612-116513634 GGGGGGAGCTGGGGAGATGTGGG + Intergenic
913353446 1:117889454-117889476 GGGTGGGATTGGGGAGATGTTGG - Intronic
914213624 1:145604797-145604819 GGGTGGGGTTGGAGAGATGTTGG + Intergenic
914395987 1:147269029-147269051 GGGTGGAGTGGGATAGAATGGGG - Intronic
914465567 1:147925211-147925233 GGGTGGGGTAGGGGAGATGTTGG + Intergenic
914895587 1:151668995-151669017 GGGGGGAGATGGAAATAAGTAGG - Intronic
915121256 1:153630675-153630697 TGGTGGAGTGGGAGTGGAGTGGG + Intronic
915622158 1:157092505-157092527 GGGTGGAGTTGGACCCAAGGTGG - Exonic
915858298 1:159414221-159414243 GGGTGGTGATGAAGAGAAGTTGG - Intergenic
916059916 1:161091410-161091432 GGTTGGAGGTGGAGAGAAACTGG - Intergenic
916178203 1:162060513-162060535 GGGTGGAGGTGGAGAGTGGGAGG - Intergenic
916838330 1:168573364-168573386 GGGTGGGGTTGGGGATATGTTGG - Intergenic
917471999 1:175333954-175333976 GTTTGGTGTTGGAGAGGAGTCGG + Intronic
917507497 1:175641284-175641306 GGGCAGGGTTGGAGAGAAGGAGG + Intronic
917621525 1:176801425-176801447 GGGTGGGGTTTGAGAGAAAAGGG + Intronic
917808432 1:178635057-178635079 GGGTGGCTTGGGAGAGAAGACGG - Intergenic
917965581 1:180176477-180176499 GGGGGGAGGTGGAGAGAAGGTGG + Intronic
918178983 1:182069901-182069923 GGGTGGAGGTGGTGACAGGTGGG - Intergenic
919207670 1:194437786-194437808 GGGTGGAGGTGGGGGGAAGGGGG - Intergenic
919496968 1:198285039-198285061 GGGTGGAGTGGGAGTGAAGCGGG - Intronic
919729048 1:200901297-200901319 TGCTGGAGTTGGAGAGAATCAGG - Intronic
919742740 1:200990540-200990562 GGGTGGAATGGAAGAGAAGGGGG + Intronic
919868707 1:201803892-201803914 GGGTGGCCTTGGGGACAAGTAGG - Intronic
920135640 1:203767253-203767275 GGGAGGGGTTGCAGAGATGTTGG - Intronic
920266695 1:204729469-204729491 GAATGGAGTTGGGGTGAAGTTGG - Intergenic
920507490 1:206526697-206526719 GGCAGAAGTTGGAGGGAAGTGGG + Intronic
920955462 1:210616325-210616347 AGGGGGTGTTGGAGAGATGTTGG - Intronic
921101461 1:211932660-211932682 GGGTGGAGTTGGGGAGGGCTGGG - Intergenic
921101467 1:211932671-211932693 GGGTGGAGTGGGGGTGGAGTTGG - Intergenic
921415576 1:214882703-214882725 TGGTGGAGTTGTGGAGAAATTGG + Intergenic
921589868 1:216990933-216990955 GGGTGGGGTTGGGGGGCAGTTGG - Intronic
921603510 1:217132676-217132698 ACGTGGAATTGGACAGAAGTGGG - Intronic
922201788 1:223409229-223409251 GGGTGGAAATGGAGGAAAGTGGG + Intergenic
922318035 1:224459610-224459632 GGGTGGGGGTGGAGTGAAGCTGG + Intronic
922342482 1:224668976-224668998 GGGAGGGGTTGGGAAGAAGTGGG - Intronic
922559932 1:226562005-226562027 GGGTGAGGTTGGGGGGAAGTGGG + Intronic
922769099 1:228172489-228172511 AGCTGGAGATGGACAGAAGTGGG - Intronic
923310524 1:232730355-232730377 TGGTAGAAATGGAGAGAAGTAGG - Intergenic
924078670 1:240369136-240369158 GGCAGGAGGTGGAGGGAAGTGGG - Intronic
924144488 1:241060017-241060039 CTGTGGAGTGGGAGAGAAATGGG - Intronic
924292270 1:242548565-242548587 GTGAGGAGATGGAGAGATGTGGG + Intergenic
1062826164 10:570475-570497 AGGAGGAGGTGGAGAGATGTGGG - Intronic
1063691374 10:8290634-8290656 AGGTGGAGGAAGAGAGAAGTAGG + Intergenic
1063906569 10:10785733-10785755 GGAAGAAATTGGAGAGAAGTTGG + Intergenic
1064308614 10:14190813-14190835 GGGTGGATTTGGGGATAAGCAGG + Intronic
1064943324 10:20759080-20759102 AGGTGGAGATGGGGAGATGTTGG + Intergenic
1065367989 10:24953159-24953181 GAGCGGAGGTGGAGAGAGGTGGG - Intergenic
1065624894 10:27620114-27620136 GGTTGGAAATGGAGAGAGGTAGG - Intergenic
1065747677 10:28857176-28857198 GTGTGGTGATGGAGAGAAGTGGG - Intronic
1065866419 10:29919059-29919081 GGGAGGAGGTGGAGAGGAGGAGG - Intergenic
1066006265 10:31148835-31148857 GGGAGAGGTTGAAGAGAAGTGGG + Intergenic
1066020952 10:31301277-31301299 TGGAGGAGTTGGAGAAATGTTGG - Intergenic
1067092620 10:43276630-43276652 GGGTGGGGCTGGGGAGATGTTGG - Intergenic
1067297086 10:44980745-44980767 GGGTGGGGCTGGAGGGCAGTGGG + Intronic
1067665092 10:48270861-48270883 TGGTGGGGTTGGAGAGAAACAGG - Intronic
1067827226 10:49585594-49585616 GTGGGGAGATGGAGAGAAGTTGG + Intergenic
1068320050 10:55400928-55400950 GGGTGGCGTGGGAGATAAGATGG + Intronic
1068979010 10:63041551-63041573 GGAGGGAGTAGGAGGGAAGTGGG + Intergenic
1069291649 10:66787421-66787443 GGGTGAGGTTGGACAGAAGTTGG + Intronic
1069724818 10:70570455-70570477 GGGTGAGGTTGGGGAGATGTTGG + Intergenic
1070285983 10:75084069-75084091 GGGTGGAGTTGGGGGGAGGATGG + Intergenic
1070495293 10:77015836-77015858 GAGTGGAGGTGGAGAGAGGTGGG - Intronic
1071233378 10:83615482-83615504 GGGTGGAGCAAGAAAGAAGTGGG + Intergenic
1071581546 10:86775988-86776010 GTCAGGAGTTGGAGAGCAGTGGG - Intronic
1072081889 10:92041039-92041061 GGGTGCAATGGGAGGGAAGTGGG + Intergenic
1072518253 10:96208032-96208054 GGGTGGAGAGGGATGGAAGTGGG + Intronic
1072945207 10:99803800-99803822 GGGTAGAGTTGGAGGAAGGTGGG + Intronic
1073119138 10:101111009-101111031 GGGTGGGGGTGGAGAAAAGTAGG + Intronic
1073301827 10:102475567-102475589 GGGAAGAGTAGGAGAGGAGTGGG + Intronic
1073362948 10:102915008-102915030 GTGTGGAATAGGAGTGAAGTCGG - Intergenic
1073447433 10:103589940-103589962 GGTTGGAGTGGGTCAGAAGTGGG + Intronic
1073513085 10:104054591-104054613 GGAGGGAGCTGGAGAGAGGTGGG + Intronic
1074353667 10:112762319-112762341 GGGTGAAGTTGGACAAAAGTAGG + Intronic
1074721879 10:116271645-116271667 AGGTGGAGTTGGGGAGCATTGGG - Intronic
1075361389 10:121838353-121838375 AGGTGGAGTTGGTGAGAAGGAGG - Intronic
1076337936 10:129721302-129721324 GGGCGGAGTTCGCGAGAAGAGGG + Intronic
1076595711 10:131623374-131623396 GGGCAGAGGTGGAGAGAGGTGGG + Intergenic
1076629332 10:131842905-131842927 GGGTGGGGTTGGGGAGGAGGTGG - Intergenic
1076734852 10:132454150-132454172 TTGTGGAGTTGGAGAGAGTTAGG - Intergenic
1076888254 10:133272318-133272340 GGCTGGGGTGGGAGGGAAGTGGG - Intronic
1077176955 11:1195419-1195441 GGTGGGTGTTGGGGAGAAGTGGG + Intronic
1077279648 11:1736850-1736872 GAGTGGAGCTGGAAAAAAGTTGG + Intronic
1077423911 11:2465643-2465665 GGGTGGAATTGGAGAGGGGAGGG + Intronic
1077536729 11:3128202-3128224 GGGGGGAGTGGGAGAGCATTGGG - Intronic
1077980217 11:7292523-7292545 GTGTGGAGTTGGAGGGGAATGGG - Intronic
1078168135 11:8908563-8908585 GGTTGGAGTGGGACAGAATTTGG - Intronic
1078416772 11:11172458-11172480 CAGTGGAGAAGGAGAGAAGTGGG + Intergenic
1078952986 11:16156332-16156354 GGGTGGAGTAATAGAGAAATGGG - Intronic
1079068553 11:17321233-17321255 GTGTGGAGTTGGGGAGTGGTGGG - Intronic
1079131409 11:17748930-17748952 GTGTGGGGCTGGAGAGAAGTTGG + Intronic
1079389610 11:20010151-20010173 GGGTGGGGTTTGAGAGATGCAGG - Intronic
1079885308 11:25981071-25981093 GGGTGGAGGTGGGGGGAAGCAGG + Intergenic
1080673711 11:34405423-34405445 GGGTGGAGGAAAAGAGAAGTGGG - Intergenic
1080747371 11:35120265-35120287 GGGTGGAAGAGGAGAAAAGTTGG + Intergenic
1081207330 11:40291521-40291543 GGGTGGAGTTGGAGAGAAGTAGG + Intronic
1081585805 11:44382797-44382819 GGGTGGCGTGGGAGTGAACTTGG + Intergenic
1081651818 11:44828880-44828902 GGGTCGTGATGGAGAGAAGAGGG - Intronic
1081744576 11:45463931-45463953 AGCTGGTGTTGGAAAGAAGTAGG + Intergenic
1082039407 11:47672631-47672653 GGGTGTATTTGGAGAGGGGTTGG + Intronic
1082785618 11:57314678-57314700 GGGAGGACGTGGAGAGAAGAGGG + Intronic
1082800456 11:57410336-57410358 CAGTGGGGTTGGAGAGAAGTGGG - Intronic
1083978823 11:66147718-66147740 GGGGGTAGTGGGAGGGAAGTGGG + Intronic
1084032704 11:66490467-66490489 GAGGGGAGCTGGAGTGAAGTTGG - Intronic
1084518119 11:69647244-69647266 GGGTGGAGTTGGGGTGTACTTGG + Intronic
1084588315 11:70076278-70076300 GGGTGCTGTTGGGGAGAAGGTGG + Intergenic
1084621530 11:70273426-70273448 GGGCATAGTGGGAGAGAAGTGGG + Intronic
1084951703 11:72670007-72670029 TGGTGGAGCAGGAGAGGAGTGGG - Intronic
1084972911 11:72781366-72781388 GTGGGGAGCTGGAGAGAGGTAGG + Intronic
1085861314 11:80239265-80239287 GGGTGGTGAGGGAGAGAAGGAGG + Intergenic
1086074866 11:82839777-82839799 TAGTGGAGTGGGAGAGGAGTTGG - Intronic
1086111179 11:83200098-83200120 GGGTGATTTTGGAGAGAAGGGGG + Intronic
1086303118 11:85451292-85451314 GTCTGCTGTTGGAGAGAAGTGGG - Intronic
1086646751 11:89231642-89231664 GGGGTGGGTTGGAGGGAAGTTGG + Intronic
1086748733 11:90463187-90463209 GTGTGGAATTGGGGAGATGTTGG + Intergenic
1086976227 11:93136357-93136379 TGGTGAGGTTGCAGAGAAGTAGG + Intergenic
1087137823 11:94738588-94738610 GGGTGTAGATGGAAAGAAGGTGG + Intronic
1087204039 11:95375277-95375299 TGGTGGAGATAGACAGAAGTGGG + Intergenic
1087744492 11:101927554-101927576 GGTGGGACTGGGAGAGAAGTAGG - Intronic
1088262164 11:107954508-107954530 AGGAAGAGTTGGAGAGACGTAGG - Intronic
1088821265 11:113459644-113459666 AGGGGGAGATGGAGAGAGGTTGG + Intronic
1089547620 11:119241842-119241864 GTGTAGAGATGGAAAGAAGTGGG + Intronic
1089573483 11:119424852-119424874 GGATGGAGTTGGAGGGAGGAGGG - Intronic
1090237640 11:125160994-125161016 AGGTGGAGTTGGGGAGGCGTTGG + Intergenic
1090266114 11:125353920-125353942 GGGTGGAGTGGGAGGGATGGGGG + Intronic
1090482542 11:127080880-127080902 GGGTGGAGTGGGAGCTGAGTGGG + Intergenic
1090663234 11:128896428-128896450 GGGTGGGGTGGGATGGAAGTGGG - Intronic
1091022697 11:132115142-132115164 GGGTGGAGTGGGAGAGAATGGGG + Intronic
1091090627 11:132768230-132768252 GGGTGGAGCTGTAGGGAACTGGG - Intronic
1091131333 11:133149561-133149583 GGGTGGGGGTTGAGAGAATTTGG - Intronic
1091145857 11:133279616-133279638 GGGTGGAGGTGGTGAGAGGAAGG - Intronic
1091228157 11:133970580-133970602 TGGTAGGGTAGGAGAGAAGTGGG - Intergenic
1091422996 12:359760-359782 GGGGGGAGTGGGAGGGAAGGAGG + Intronic
1091598839 12:1904230-1904252 CGATGGGGTTGGGGAGAAGTGGG + Intronic
1091626690 12:2126584-2126606 AAGTGGAGGTGGAGAGAAGACGG + Intronic
1091828490 12:3532968-3532990 GGGTGGAGACTGAGAGCAGTGGG + Intronic
1091897520 12:4117271-4117293 AGGAGGAGCAGGAGAGAAGTCGG - Intergenic
1092242536 12:6843997-6844019 GGAAGGAGTTGGAGTGAAGCTGG - Intronic
1092518234 12:9238357-9238379 TAGTAGAGATGGAGAGAAGTGGG + Intergenic
1092798209 12:12135338-12135360 GAGTGGAGGGGGAGAGAAGTGGG + Intronic
1093093246 12:14944330-14944352 GGGTGGCATTGGAGGGAAGGGGG - Intronic
1093210538 12:16303057-16303079 GGGAGGAGTTGGAAGAAAGTGGG - Intergenic
1093514139 12:19965743-19965765 GGTTGGTGTTGGTGGGAAGTGGG + Intergenic
1094009552 12:25792826-25792848 TGATAGGGTTGGAGAGAAGTGGG + Intergenic
1094128710 12:27051764-27051786 GGGAAGAGATGGTGAGAAGTGGG + Intronic
1094339224 12:29392107-29392129 GGTTGGTGGTGGAGAGGAGTTGG + Intergenic
1094439273 12:30456941-30456963 GGGTGGAGTGAGACAGAAGTGGG + Intergenic
1095382528 12:41612713-41612735 GGGAGGAGTTGGGGAGAGGGAGG - Intergenic
1096052298 12:48621270-48621292 GGGTGGAGATGGAGGGAATGGGG + Intergenic
1096083620 12:48850196-48850218 CGATGGAGATGGAAAGAAGTAGG + Intronic
1096571959 12:52528693-52528715 GGGTAGAGATGGAGAGCATTTGG - Intergenic
1096720963 12:53521405-53521427 GAGAGTAGTTGGAGACAAGTAGG - Intronic
1096806265 12:54143016-54143038 AGGAGGGGTTGGAGAGAGGTGGG + Intergenic
1097257441 12:57690227-57690249 GTGTGGGGTTGAGGAGAAGTGGG - Intergenic
1098534534 12:71579769-71579791 GGGTGGACTTGGGGGGAAGTGGG - Intronic
1098556113 12:71820885-71820907 GGGTGGGGTTGGAGAGATATTGG - Intergenic
1099039959 12:77640409-77640431 GGATGGAAATGGAGAGAAGTAGG - Intergenic
1099524655 12:83704977-83704999 GCCTGGAGTTGGGGAGAGGTGGG - Intergenic
1100461633 12:94805449-94805471 GGGTGGAGTTGGGGAGATACAGG - Intergenic
1100569749 12:95836956-95836978 GGGAGGAGATGGAGAGGAGAGGG + Intergenic
1101087887 12:101254807-101254829 GGGTGGATGTGGAGAGAACATGG + Intergenic
1101580659 12:106038585-106038607 CCGTGGAGTTAGAGAGAACTGGG + Intergenic
1101816581 12:108150557-108150579 GGGTGGAGTTGGAGTATGGTAGG + Intronic
1102172585 12:110853381-110853403 TGGGGGAGATGGAGAGGAGTGGG - Intronic
1102233447 12:111279247-111279269 GGGTATAGCAGGAGAGAAGTAGG + Intronic
1102419431 12:112792206-112792228 GGGAGGAGTTGGCAAGAATTTGG + Exonic
1103052342 12:117791091-117791113 GGGTGAGGTGGGAGAGATGTGGG - Intronic
1103091824 12:118103500-118103522 GGGCGGAGTCGGAGGGAATTGGG + Intronic
1103325243 12:120116311-120116333 CTCTGGAGTTGGAGAGACGTGGG - Intronic
1103948730 12:124540690-124540712 GGGTGGAGATGGAGGGGGGTGGG + Intronic
1104278717 12:127354140-127354162 TGGTGGAGGTGGAGGGAAGTGGG + Intergenic
1104666828 12:130653555-130653577 CAGTGGAGTTGGTGAGAAGAGGG - Intronic
1105211056 13:18257293-18257315 GGGTGGAGATGGAGAGAGTTAGG + Intergenic
1106101597 13:26698139-26698161 GGCTGGCTTTGGAGAGAAGAGGG - Intergenic
1106473969 13:30081533-30081555 GGGTGGGGTTGGGGGGAAGGTGG - Intergenic
1106495760 13:30272948-30272970 GGGTGTGGTTGTAGAGAGGTGGG - Intronic
1106929190 13:34645491-34645513 CGGAGCAGTTGGAGAGGAGTAGG + Intergenic
1106984787 13:35333673-35333695 TTGAGGAGTTGGAGAGAGGTAGG - Intronic
1107223482 13:38016844-38016866 GAGTGGAGGTGAAGAGAGGTTGG - Intergenic
1108563971 13:51676094-51676116 GGATGGAGTGGGAGAGAGGGAGG - Intronic
1108690073 13:52851540-52851562 AGGTGGCGCTGGAGAGGAGTAGG + Intergenic
1108703932 13:52968127-52968149 TGGTGGAGGTGGAGGAAAGTCGG - Intergenic
1108929449 13:55798297-55798319 GGGTGGAGAAGGAGAGAATGGGG - Intergenic
1108994096 13:56702699-56702721 GGAGGGGGTTGGAGAGATGTTGG + Intergenic
1109107629 13:58275771-58275793 AGGTGGAGGGGGAGAGGAGTTGG - Intergenic
1109370830 13:61417084-61417106 AGGTGGAGTGGGAGAGGGGTAGG - Intronic
1110723718 13:78795335-78795357 GGGTGGAGGGGGAGAGAAAGTGG - Intergenic
1111897855 13:94163323-94163345 AGGTGGAGGTGGAAGGAAGTAGG - Intronic
1112566820 13:100558991-100559013 GGATGGAGGAGGAGAGAAATAGG + Intronic
1113000522 13:105630545-105630567 GGGTAGAGTAGGACAGCAGTGGG + Intergenic
1113237895 13:108301646-108301668 GGGTGGAGGTGAAAAGACGTTGG + Intronic
1113240980 13:108336632-108336654 CGGGGGTGTTGGAGAGAGGTAGG - Intergenic
1113349344 13:109513336-109513358 TGGTGGAGTTGGAGATATATGGG - Intergenic
1113566187 13:111320975-111320997 GGGTGGGGTGGGGGAGCAGTTGG + Intronic
1113574023 13:111382002-111382024 GGGTGGGGTTGCAGAGACGGTGG + Intergenic
1113933455 13:113980871-113980893 GGGTGGAGGAGGAGAGAGGGAGG + Intronic
1114274818 14:21133223-21133245 GGAGGGAGTTGGGGAGATGTTGG + Intergenic
1114294832 14:21319679-21319701 GGGTGGAGTTGGTGAGATACTGG + Intronic
1114523649 14:23354125-23354147 TGGTAGAGATGGAGAGATGTGGG - Intergenic
1114703756 14:24705421-24705443 GGGTGGGGGTGGGGAGCAGTGGG + Intergenic
1115256955 14:31413266-31413288 GGGTGGAGTAGGAGAGAAACAGG + Intronic
1115669778 14:35597688-35597710 GGATAGAGTAGGAGTGAAGTGGG - Intronic
1117108384 14:52422255-52422277 AATTGGAGTTGGAGGGAAGTGGG + Intergenic
1117124991 14:52613483-52613505 TGGAGGGGTTGGGGAGAAGTGGG - Intronic
1117840588 14:59856650-59856672 GATTGGGGGTGGAGAGAAGTCGG - Intronic
1117996960 14:61487094-61487116 GGGTGGTGCTGGAGATAAGTGGG + Intronic
1118227956 14:63920714-63920736 CCGTGGAGATGGAGAGAAATAGG + Intronic
1118912764 14:70075588-70075610 GGGTGGTGTGGCAGAGAAGACGG - Intronic
1118924836 14:70182646-70182668 GGGAGAAGGTGGAGAAAAGTGGG + Intronic
1119402218 14:74370661-74370683 TGGTGGAAGTGGAGAGAAGTAGG - Intergenic
1119457774 14:74770946-74770968 TAGTTGAGATGGAGAGAAGTGGG + Intronic
1119974597 14:79011385-79011407 GGGTGGGGTTGGGGGGAGGTGGG - Intronic
1120085931 14:80272741-80272763 AGTTGGAGTTGGAGAGCTGTAGG - Intronic
1120138676 14:80901763-80901785 AGGTGGAGCTGGAGAGAAGGAGG - Intronic
1122061092 14:99137198-99137220 GGGTGGAGGTGGAGAAATGAAGG - Intergenic
1122092046 14:99347229-99347251 GGTTCGAGGTGCAGAGAAGTAGG + Intergenic
1122373705 14:101243989-101244011 GGATGGGGTTGGGGAGAAGAAGG - Intergenic
1122606048 14:102948228-102948250 GTGTGGAGGTGGAGGGGAGTCGG + Intronic
1122629156 14:103099438-103099460 TGGTGGAGAGGGAGAGGAGTGGG + Intergenic
1123105846 14:105840729-105840751 GGGGGCACTGGGAGAGAAGTGGG + Intergenic
1124504019 15:30256428-30256450 GGAAGGAATTGCAGAGAAGTAGG - Intergenic
1124739534 15:32282218-32282240 GGAAGGAATTGCAGAGAAGTAGG + Intergenic
1125241927 15:37585953-37585975 GTTTGGAGATGGAGAGTAGTGGG - Intergenic
1125672569 15:41484683-41484705 GGGTGCAAGTGGAGAGAAGAAGG + Intergenic
1126957774 15:53953416-53953438 GGGTTGAATTGGACAGAAGTTGG - Intergenic
1127002791 15:54529720-54529742 GTGTGGAGGAGGAGAGGAGTGGG + Intronic
1127018816 15:54721992-54722014 AGGGGGAGTTGGAGGGAAATGGG - Intergenic
1127038089 15:54941932-54941954 TGGTAGAGGTGGAGAGAAGAGGG - Intergenic
1127201504 15:56658185-56658207 GGGAAGAGCTGGAGAGAAATGGG + Intronic
1127492703 15:59480047-59480069 TGGTGGAGATGGGGAGAAGATGG + Intronic
1127749613 15:62021140-62021162 GGGTAGGGTGGGTGAGAAGTAGG + Intronic
1128261112 15:66233687-66233709 GAGTCATGTTGGAGAGAAGTGGG - Intronic
1128511818 15:68318247-68318269 GAGTGGAGGTAAAGAGAAGTGGG - Intronic
1128531180 15:68449171-68449193 GGGTAGAGTGAGAGAAAAGTGGG - Intergenic
1129714612 15:77839866-77839888 TAGTGGGGTTGGAGAGAAATGGG - Intergenic
1129775557 15:78234110-78234132 GGCTGCAGTTGGAGACCAGTTGG - Intronic
1130853178 15:87817939-87817961 GGGAAGAGTTGGAGAGAATTAGG + Intergenic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1130960558 15:88656061-88656083 CTGTGGAGTCAGAGAGAAGTAGG + Exonic
1131545828 15:93314754-93314776 AGGTGGAGATGGTGAGAAGGTGG + Intergenic
1132048776 15:98589596-98589618 GGGAAGGGTGGGAGAGAAGTCGG + Intergenic
1132075743 15:98818416-98818438 GGGTGGAGAAGGGGAGAAGGAGG + Intronic
1132912728 16:2323749-2323771 GGGTGGAGTGGGAGAGCGCTTGG + Intronic
1133047733 16:3098574-3098596 AGGTGGAATTCGAGACAAGTTGG + Intronic
1133313706 16:4868695-4868717 GGGTGGAGTTGGAAAGGTGGCGG + Intronic
1133537070 16:6712708-6712730 GAGGGGAGGTGGGGAGAAGTGGG - Intronic
1133699155 16:8293061-8293083 TGGGGGAGTTGGGGAGATGTTGG + Intergenic
1133715274 16:8441392-8441414 GGGGGTGGTTGGAGAGGAGTTGG + Intergenic
1134442499 16:14307641-14307663 GGCTGGAAGTGGAAAGAAGTGGG + Intergenic
1134517516 16:14899107-14899129 GGGAGGAGTTGGAAAGAGTTTGG + Intronic
1134705184 16:16297758-16297780 GGGAGGAGTTGGAAAGAGTTTGG + Intergenic
1134962357 16:18414356-18414378 GGGAGGAGTTGGAAAGAGTTTGG - Intergenic
1134966654 16:18496955-18496977 GGGAGGAGTTGGAAAGAGTTTGG - Intronic
1135850256 16:25957040-25957062 GGGTGGATCTGGAGACAAGGAGG + Intronic
1135896682 16:26411568-26411590 GGGTGGGGATGGGGAGATGTAGG + Intergenic
1136367389 16:29815016-29815038 GGGTGGAGGTCCAGAGAATTTGG - Intronic
1137718448 16:50613030-50613052 GGTTGGAGCTGGTGAGAAGGGGG + Intronic
1138243125 16:55445249-55445271 GGAAGGAGGTGGAGAGGAGTAGG - Intronic
1138634692 16:58328376-58328398 GGGTGGGGATGGGGAGAAATGGG - Intronic
1139120215 16:64007274-64007296 GTGTGGAGAGAGAGAGAAGTGGG - Intergenic
1139197029 16:64931182-64931204 GGGTGGAAATGGGGAGAAGTAGG + Intergenic
1140142119 16:72268164-72268186 GGGGAGGGTGGGAGAGAAGTGGG - Intergenic
1140276154 16:73510806-73510828 GTGTGGACTTAGGGAGAAGTTGG - Intergenic
1140880574 16:79194593-79194615 GGGTGGAGAAGGATGGAAGTGGG - Intronic
1142134178 16:88444094-88444116 AAGTGGGGTAGGAGAGAAGTGGG + Intergenic
1142228427 16:88888489-88888511 GGGTGGGGTTGGGGAGGGGTGGG + Intronic
1142254429 16:89006954-89006976 GGGAGGAGATGGAGGGGAGTGGG - Intergenic
1142254457 16:89007032-89007054 GGGAGGAGATGGAGGGGAGTGGG - Intergenic
1142254495 16:89007145-89007167 GGGAGGAGATGGAGGGGAGTGGG - Intergenic
1142290869 16:89193110-89193132 GGGTGGTGTTGGGGAGGAGGCGG - Intronic
1142555499 17:773867-773889 GGGTGAAGCTGCACAGAAGTGGG + Intronic
1142933545 17:3308805-3308827 GGGTGGAGTTGGAGACCACTAGG - Intergenic
1143023405 17:3928110-3928132 GTGTCGGGCTGGAGAGAAGTGGG - Intronic
1143448111 17:7020427-7020449 GGGGGAAGTTGGAGAAAAATGGG - Intergenic
1143532490 17:7513375-7513397 GGGTGAAGTTGGCGAGTAGCTGG - Exonic
1144761859 17:17711520-17711542 GGATGGAGCTGGAGGGAAGTGGG + Intronic
1146499169 17:33349562-33349584 GGGTGGAGCTGGAGGGCATTCGG - Intronic
1146556240 17:33826742-33826764 GGGTGGAGTAGGAGAGATATAGG + Intronic
1146587584 17:34095578-34095600 GGGAAGAGTTGGGGAGAAGCAGG + Intronic
1146700980 17:34960079-34960101 CAGTGGAGATGGAGAGAAGGTGG - Intronic
1147441842 17:40452420-40452442 TGGCTGAGTGGGAGAGAAGTGGG - Intronic
1147768226 17:42851036-42851058 GGTTGGAGTTGGGGAGAGTTGGG - Intergenic
1148533285 17:48415844-48415866 GCTTGGAGTTGGAGAGGAGGGGG + Intronic
1148751670 17:49948894-49948916 GGGAGGAGTGGGAGGGAGGTGGG + Intergenic
1148760929 17:49999636-49999658 GGGTAGAAGTGGAGAGCAGTGGG + Intergenic
1148801943 17:50233563-50233585 GGGTAGAGTGGGAGAGAAAAGGG - Intergenic
1149901946 17:60488494-60488516 GCCTGGTGTTGGAGAGAAATGGG + Intronic
1150206188 17:63410322-63410344 GGGGGGGATTGGAGAGATGTTGG - Intronic
1150317594 17:64182614-64182636 GGGAGGAGTTGGGGAGGAATAGG - Intronic
1150628610 17:66859846-66859868 GGGTGGAGAGGGAGAGAAGAGGG - Intronic
1150629798 17:66871402-66871424 GGGTTTAATTGGAGAGAAGGAGG - Intronic
1151189490 17:72387754-72387776 GGGGAGGGGTGGAGAGAAGTGGG + Intergenic
1151231199 17:72686418-72686440 GGGTGGAGCGGGACAGCAGTGGG - Intronic
1151757648 17:76083785-76083807 GGGTGGAGCTGGGGAGGGGTCGG - Intronic
1152301131 17:79495713-79495735 GGGTGCAGATGGAGGGAGGTGGG + Intronic
1152334106 17:79690567-79690589 GGGTGGATTTGGACTGAGGTGGG + Intergenic
1153098343 18:1435428-1435450 CAGTGAAGTTGGAAAGAAGTAGG - Intergenic
1153427041 18:4976120-4976142 GGAGGGAGATGAAGAGAAGTAGG + Intergenic
1153683946 18:7526797-7526819 GGGAGGAGTTAGTGAGAAGGTGG - Intergenic
1153770931 18:8416039-8416061 GGGAGGAGATGGAGAGAGGGTGG - Intergenic
1153948409 18:10037012-10037034 GTGTGGTGTTGGAGAGTTGTGGG + Intergenic
1154130733 18:11734920-11734942 TGATGGACTTGCAGAGAAGTGGG + Intronic
1154203595 18:12318264-12318286 GGGAAGGGGTGGAGAGAAGTTGG + Intronic
1154433176 18:14324008-14324030 GGGTGGGGTTAGAGGGAAGGGGG + Intergenic
1154496589 18:14965735-14965757 GTCTGGAGTGGGAGAGCAGTGGG - Intergenic
1155530326 18:26760091-26760113 CCTTGGAGTTGGAGAGAAGGGGG + Intergenic
1155662045 18:28260811-28260833 GGGTGGAGATGAAGAGAAGTTGG + Intergenic
1155979276 18:32163859-32163881 GGGTGGGGGAGGAGAGAAGGGGG + Intronic
1156371924 18:36478822-36478844 GGGTGGAGGTGGGGAGGATTGGG - Intronic
1157279339 18:46335369-46335391 GAGTGGAGGTGGGGAGAAGAGGG - Intronic
1157328446 18:46686013-46686035 GGATGGGGCTGGAGAGAAGAAGG + Intronic
1157428289 18:47602481-47602503 GGGTGGAGTCAGGGAGCAGTGGG + Intergenic
1157515312 18:48307002-48307024 GGGTGGAGTGGGAGAGTGGAGGG - Intronic
1157880641 18:51318094-51318116 GTGGGTAGGTGGAGAGAAGTAGG - Intergenic
1158108539 18:53913680-53913702 GGATGAAGTTGGGGAGATGTTGG - Intergenic
1158123358 18:54075155-54075177 GGGTGGAGTGGGAGGGAGGTGGG - Intergenic
1158636402 18:59162299-59162321 GGGTGGGGTAGGATAGAAGGAGG + Intergenic
1158858255 18:61565744-61565766 GCTTGGGGTTGGAGAGGAGTAGG - Intergenic
1159107458 18:64019438-64019460 GGATGGAGTCGAGGAGAAGTGGG - Intergenic
1160427119 18:78786130-78786152 GTGAGGAGTTGGGGAGGAGTGGG + Intergenic
1161398534 19:4057820-4057842 GGGTGGAACTGGCGGGAAGTAGG - Intronic
1161723492 19:5915977-5915999 GGGTGGTGGTGGAGAGAACAGGG + Exonic
1161766283 19:6210783-6210805 GGGTGGGGTGGGAGAGCAGCTGG + Intergenic
1162222893 19:9193754-9193776 GGAGGGGGTTGAAGAGAAGTTGG + Intergenic
1162524156 19:11197666-11197688 GGGTGGGGATGGAGAGACGCTGG + Intronic
1163028933 19:14530934-14530956 AGGTGGAGGTGGAGAGGAATGGG - Intronic
1163255953 19:16155968-16155990 TGGTGGAGATGGAAAGAAGGAGG + Intronic
1163339924 19:16699065-16699087 GGTGGGTGTTGGAGATAAGTCGG + Intergenic
1163480551 19:17553583-17553605 AGGTGGGGTTGGAGGGAAATAGG - Exonic
1163546097 19:17942284-17942306 GGCTGGAGTGGGAGTGAAGCGGG - Intronic
1163779552 19:19239383-19239405 GGGAGGAGTGGGAGGGAAGATGG - Intronic
1163779688 19:19239840-19239862 GGGAGGAGTTGGAGGGAGGAGGG - Intronic
1164324504 19:24179980-24180002 AGGTGGAGGAGGAGAGAAGGAGG + Intergenic
1164733646 19:30524688-30524710 GGGTGGAGGAGGGGAGAAGATGG - Intronic
1164996069 19:32720781-32720803 GGGTGGGGTTGGAGTGGAGGTGG - Intronic
1165321733 19:35089748-35089770 GGGTGGAGGTGGACACAGGTCGG - Intergenic
1166044219 19:40220158-40220180 GGGTGGAGTTGGGGAGAGTGGGG - Intergenic
1166516931 19:43454125-43454147 GGGTGGAAGTGAAGAGATGTGGG + Intergenic
1166518862 19:43465835-43465857 GTTTGGAGTGGGAGAGTAGTGGG + Intergenic
1166532854 19:43552937-43552959 GGGTGGAGGAGGAGAGAAGCTGG - Intronic
1166631405 19:44410800-44410822 GGGCGTAGTTGGAGAGTAGCTGG - Intergenic
1166813521 19:45528038-45528060 GGGCAGATTTGGAGGGAAGTTGG + Exonic
1166897289 19:46032158-46032180 GGTTGGAGCTGGGGACAAGTGGG + Intergenic
1166943612 19:46383897-46383919 GGGTGGAGGTGGGGAGAGGGTGG - Intronic
1167063989 19:47170478-47170500 GGGGGGCGGTGAAGAGAAGTTGG - Intronic
1167087749 19:47321877-47321899 GTGTGGGGGTGGAGGGAAGTGGG - Exonic
1167313298 19:48750026-48750048 TGGGAGAGTTGGAGAGAAGGGGG - Exonic
1167331216 19:48857459-48857481 GGGGGGAGCTGGAGATAAGTGGG + Exonic
1167569664 19:50279139-50279161 GGGTGGGGTGGGGGAGAAGTGGG - Intronic
1167843064 19:52138205-52138227 GGATGGAGGAGGAGAGAAATAGG - Intronic
1167880567 19:52454012-52454034 GGGTGGATTAGGAGAGGGGTGGG - Intronic
1168099486 19:54133743-54133765 GAGGGGAGGTGGAGAGAAGGAGG - Intergenic
925095862 2:1201400-1201422 GGGGGGAGGTGAAGAGAAGTTGG + Intronic
925615255 2:5739257-5739279 GACAGGAGTGGGAGAGAAGTCGG - Intergenic
926584539 2:14671905-14671927 GGGTGGAGTGGGGAAGGAGTTGG - Intergenic
926604640 2:14885251-14885273 GAGTAGAGATGGAGAGAAATGGG + Intergenic
926707848 2:15849314-15849336 AGGGGGAGGTGGAGAGAAGATGG + Intergenic
927485024 2:23482701-23482723 GGGTGGAGTTGGAGGGAGAGAGG - Intronic
927884536 2:26710393-26710415 GGGTGCAGATGAAGAGCAGTGGG + Intronic
928030552 2:27774812-27774834 GGATGAAGTTGGAGAGTGGTAGG + Intronic
928142412 2:28741286-28741308 GGATGGTGTTGAAGAGAAGTTGG + Intergenic
928898955 2:36297382-36297404 GAGTAGAGTTGGAGAGAATGTGG - Intergenic
928922453 2:36539659-36539681 CCGTGGAGGTGGGGAGAAGTGGG + Intronic
929242223 2:39665511-39665533 AGGAAGAGTTGGAGAAAAGTCGG + Intronic
929868821 2:45740646-45740668 GGGAGGAGTTTGAGAGAATGGGG - Intronic
929923370 2:46189422-46189444 GGGTGGAAATGGGGAGATGTTGG + Intergenic
930547945 2:52793485-52793507 AGTTGGAGTTGGAGAGAAAAAGG + Intergenic
930568896 2:53059600-53059622 GGAGAGAGTTGGAGAGATGTTGG + Intergenic
930731654 2:54733920-54733942 AGGTGGAGTAGAAGAGAAGGAGG + Intronic
930749751 2:54922896-54922918 GGGTGGAAATGGGGAGATGTTGG + Intronic
931614821 2:64144757-64144779 AGTTGGAGGTGGAGAAAAGTAGG - Intergenic
931719260 2:65055719-65055741 TGATGGAGTCGGAGGGAAGTGGG - Intergenic
931810646 2:65851422-65851444 TAGTGAAGATGGAGAGAAGTGGG + Intergenic
932450837 2:71809786-71809808 GGCTGGAGCTGCAGAGAAGCAGG + Intergenic
932608990 2:73184642-73184664 GGGTGAAGTTAGAGAGAAAGAGG + Intergenic
933679216 2:85084307-85084329 GGGTGGGGTGGGAGAAAAGTAGG + Intergenic
933945411 2:87281985-87282007 GTGTGGAGTTGGAGATGAGGAGG + Intergenic
934034645 2:88078790-88078812 GGCTGGAGCTGGGGAGAAGGAGG - Intronic
934502233 2:94870328-94870350 GGGTGAAGGTGGAGAGAACAGGG + Intergenic
934905338 2:98196123-98196145 GGGTGGGGATGGGGAGATGTTGG + Intronic
935793457 2:106615533-106615555 GAGTGGATTTGGGGAGAAATTGG + Intergenic
935830625 2:106997683-106997705 GGAAGCAGTTGGAGAGAAGATGG + Intergenic
936019441 2:108983737-108983759 CTTTGGAGTTGGAGAGAAGGTGG - Intronic
936334799 2:111579605-111579627 GTGTGGAGTTGGAGATGAGGAGG - Intergenic
936679797 2:114757147-114757169 GGGTGGGGAGGGAGAGAGGTGGG + Intronic
936680073 2:114760013-114760035 TGGTGCAGGTGGTGAGAAGTGGG - Intronic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
936911902 2:117602240-117602262 TGGGGGAGATGGAGAGAAGCAGG - Intergenic
937305450 2:120867795-120867817 GGGGGGAGCTGGAGGGAAGGAGG + Intronic
937332656 2:121041988-121042010 GGGTGCAGTTGGGGAGGACTTGG + Intergenic
937575560 2:123417380-123417402 GGGTGGAGTTTGAGAGGAGGGGG - Intergenic
937954916 2:127416767-127416789 GGGTGGAGGTGGAGAGGAGGTGG - Intergenic
938240501 2:129739199-129739221 GGGATGAGTTGGAGAGGAGGTGG - Intergenic
938391886 2:130913197-130913219 TTGTGGAGTTGGAGGGAAGCAGG + Intronic
938411863 2:131071777-131071799 GGGTGGATTTTGAGAGGGGTGGG - Intronic
938540726 2:132281678-132281700 GGGTGTAGTTGGAGAGTAGCTGG + Intergenic
938541581 2:132287728-132287750 GGGCGTAGTTGGAGAGTAGCTGG + Intergenic
938566697 2:132525151-132525173 TGGGGGAGTTTAAGAGAAGTGGG - Intronic
938866657 2:135428892-135428914 TGGTGGGGTTGAAGAGAAATGGG + Intronic
938965964 2:136388764-136388786 GGGAAGAGTTGGAGAGAGATGGG + Intergenic
939853406 2:147327204-147327226 GGGAGGAAATGGAGAGATGTAGG + Intergenic
940111656 2:150161480-150161502 TGGAGGAGTTGGAGTGCAGTGGG + Intergenic
940917633 2:159274524-159274546 GGGTGAAGTTGGGGAGAGATTGG - Intronic
941447301 2:165617915-165617937 GAGTGGATGTGGAGAGATGTTGG + Intronic
941610975 2:167661906-167661928 GGGTGGGTTTGAAGACAAGTAGG + Intergenic
941695638 2:168548312-168548334 GAAGGGAGTGGGAGAGAAGTGGG + Intronic
943577769 2:189651403-189651425 GGGAGGATTTGGGGAGATGTTGG + Intergenic
943896779 2:193372877-193372899 AGGTGGTGTGGGAGGGAAGTTGG - Intergenic
944877058 2:203972939-203972961 GAGTGGAGTTGGAGAAGAGTGGG - Intergenic
945485302 2:210388260-210388282 GGGTGGAGGAGGAGAGAGTTTGG + Intergenic
945779135 2:214146220-214146242 ATGTGGAGATGGAGAGATGTGGG - Intronic
946199637 2:218064357-218064379 GCAGGGAGTTGGAGAGGAGTGGG - Intronic
946313684 2:218896580-218896602 GGGGGGAGGAGGAGAGAAGGGGG - Intronic
946919232 2:224560692-224560714 GAGTGGAGATGGAGACCAGTTGG - Intronic
947001694 2:225464412-225464434 GGGAGAAGGTGCAGAGAAGTAGG + Intronic
947387731 2:229608710-229608732 GGGTAGAGAGGGAGGGAAGTGGG + Intronic
947433284 2:230049623-230049645 GGGAGGGGTTGGGGTGAAGTGGG + Intronic
948334055 2:237194006-237194028 GGGCTGAGCTGGAGTGAAGTGGG - Intergenic
1168930294 20:1617536-1617558 GGGTGCATTTGGAGAGATATTGG + Intronic
1169344721 20:4821284-4821306 ATGTGGAGATGGAGAGAGGTGGG + Intronic
1169951217 20:11045583-11045605 GGGTGGAGTTGGAGATAAAATGG - Intergenic
1171427174 20:25056691-25056713 GGGAGGAGTTGGAGAAAATGGGG + Intronic
1171870397 20:30520312-30520334 GGGTGTGGTTGGAGAGTAGCTGG + Intergenic
1171870449 20:30520604-30520626 GGGAGTAGTTGGAGAGTAGCTGG + Intergenic
1172407739 20:34702154-34702176 AGGTGAAGCTGGAGAGAACTGGG + Intronic
1172581004 20:36048085-36048107 GGTTGGTGGTGGAGAGGAGTTGG - Intergenic
1172790505 20:37502095-37502117 AGGTGGAGCTGGAGAGAAGGAGG - Intronic
1173902618 20:46601895-46601917 GGGTGGAGGTGGTAGGAAGTGGG + Intronic
1173915844 20:46708587-46708609 TGGTGAGGTTGGAGAAAAGTAGG - Intergenic
1174444684 20:50582722-50582744 GGGTGGAGGTGGAGTGGAGGAGG - Exonic
1174986746 20:55462756-55462778 GGGTTGATTTGCAGAGCAGTTGG + Intergenic
1175005788 20:55681180-55681202 GGGAGCAGTTGGGGAGATGTTGG + Intergenic
1175336047 20:58197073-58197095 GGGTGGAGTGGGAGAGGAGGAGG - Intergenic
1175487417 20:59355801-59355823 GGGGGGAGAGGGAGAGAAGAGGG - Intergenic
1175663708 20:60840128-60840150 GGTTGGAGTAGGAGAGAAGATGG - Intergenic
1175857306 20:62129015-62129037 GGGAGGAGATGGAGAGAGGTGGG + Intronic
1175863056 20:62160313-62160335 GGGGAGAGGTGGAGAGAGGTGGG + Intronic
1175863065 20:62160338-62160360 GGGGAGAGGTGGAGAGAGGTGGG + Intronic
1176025231 20:62982256-62982278 GGGAGGAAGTGGAGAGAGGTGGG - Intergenic
1176028435 20:62998211-62998233 GGCTGGAGGTGGAGGGACGTGGG + Intergenic
1177618273 21:23554584-23554606 GGGTGGAGGTTGAAAGAATTTGG + Intergenic
1177722930 21:24930180-24930202 AAGTGGAGATGGAGAGAAGGGGG - Intergenic
1178596858 21:33962161-33962183 GAGTGGAGTTGGAGAGAAACAGG + Intergenic
1178859358 21:36276047-36276069 TGGTGGAGCTGGAGCGGAGTCGG + Intronic
1179224626 21:39442808-39442830 GGGTCAAGTTGGAGAAAGGTAGG + Intronic
1179339966 21:40497473-40497495 GTGGGGAGTTGGGGAGATGTTGG + Intronic
1179461091 21:41535900-41535922 GGCTGGATTTGGAGAGGAGAGGG + Intergenic
1179950088 21:44704388-44704410 GGGTGGACTTGGCTAGAAGGAGG - Intronic
1180047510 21:45316413-45316435 GGGTGGGGGTGGAGAGCATTAGG + Intergenic
1180230999 21:46426713-46426735 GGGAGGACTTGGGGAAAAGTGGG - Intronic
1180352505 22:11816349-11816371 GGGCGTAGTTGGAGAGTAGCTGG + Intergenic
1180385750 22:12176008-12176030 GGGCGTAGTTGGAGAGTAGCTGG - Intergenic
1180765191 22:18342143-18342165 GGGTGGAGACGGAGAGAGTTAGG - Intergenic
1180813839 22:18777541-18777563 GGGTGGAGACGGAGAGAGTTAGG + Intergenic
1181000925 22:19987377-19987399 GGGGGGAGGTGGTGGGAAGTGGG - Intronic
1181167135 22:20989777-20989799 GGGTGCAGGTGGAGGGAGGTGGG + Intronic
1181171190 22:21011226-21011248 GGCTGGAGTGGAAGAGGAGTGGG + Intronic
1181178155 22:21049293-21049315 GGCTGGAGTGGAAGAGGAGTGGG - Intronic
1181200024 22:21211876-21211898 GGGTGGAGACGGAGAGAGTTAGG + Intronic
1181701711 22:24625083-24625105 GGGTGGAGACGGAGAGAGTTAGG - Intronic
1182074733 22:27487991-27488013 GGATGGAGTTGCAGAGGAGGTGG - Intergenic
1182149059 22:28016002-28016024 GGGAGGAGTGGGAGAGAGCTAGG - Intronic
1182534262 22:30988496-30988518 CTTTGGAGTTGGAGAGAAGATGG + Intergenic
1182738583 22:32548998-32549020 GGATGGAGCTGGAGGGATGTTGG + Intronic
1182760784 22:32720900-32720922 GGAAGGAGTTGCAGAGAGGTGGG - Intronic
1183302901 22:37067055-37067077 GGGCAGAGCAGGAGAGAAGTAGG - Intronic
1183377055 22:37471492-37471514 GGATGGGGGTGGAGAGGAGTTGG - Intronic
1183830194 22:40414704-40414726 GGCTGGAGTTGGGGAGAATGGGG + Intronic
1184968740 22:48000085-48000107 GAGTGGAGATGGGGAGAGGTTGG - Intergenic
1185117982 22:48948966-48948988 GGCTGGAGTGGGAGTGAGGTTGG - Intergenic
1203226812 22_KI270731v1_random:83048-83070 GGGTGGAGACGGAGAGAGTTAGG - Intergenic
1203263938 22_KI270734v1_random:3228-3250 GGGTGGAGACGGAGAGAGTTAGG + Intergenic
949649924 3:6145502-6145524 GGGTGGGGCAGGAGGGAAGTAGG - Intergenic
949736089 3:7173377-7173399 GGGTGGAGCCGGAGAGGGGTGGG - Intronic
950077598 3:10198325-10198347 GGGAGGAGTTGGGGAGACATCGG - Intronic
950230913 3:11275061-11275083 CAGTGGAGATGGAGAGGAGTGGG + Intronic
950333166 3:12173378-12173400 GGGTGGAGGTGCAGATAAGTGGG - Intronic
951207513 3:19939994-19940016 AGGTGGTGTTTGAGAGATGTCGG - Intronic
951606165 3:24437389-24437411 GGGGGAAGATGAAGAGAAGTTGG + Intronic
952135970 3:30420082-30420104 GGCTGGCGGTAGAGAGAAGTAGG + Intergenic
952227431 3:31392724-31392746 GTGCTGAGGTGGAGAGAAGTAGG - Intergenic
952835363 3:37597445-37597467 TGGTGGAGGTGAAGAGAAGAGGG + Intronic
952901383 3:38114178-38114200 GAGTGGAGATGGCGGGAAGTGGG + Intronic
953164175 3:40449804-40449826 GGTTGCAGCTGGAGACAAGTTGG - Intergenic
953389966 3:42528220-42528242 GGGTGGGGTGGGAGGGAAGAGGG - Intronic
953494691 3:43375949-43375971 GGGTGCAGTTGGTAATAAGTTGG - Intronic
953496304 3:43390254-43390276 GGAGGGAGCTGTAGAGAAGTGGG - Intronic
953772945 3:45792718-45792740 GTGTGGGGTTGGGGAGAGGTGGG - Intronic
954217750 3:49133784-49133806 GCGTGGAGGGGGAGAGAAGGAGG + Intergenic
954515215 3:51169094-51169116 TGGTGAAGTTGCAGAGAAGAGGG + Intronic
954998458 3:54903690-54903712 TGGTGAAGTTGGAGAGAAAAAGG - Intronic
955521236 3:59777552-59777574 TAGTGGAGGTGGAGAGAAATAGG - Intronic
955618381 3:60833784-60833806 GGGTGGAGTGGGAGGGAAGTGGG - Intronic
955632048 3:60985152-60985174 GGGAGGAGGTGAAGAGTAGTGGG - Intronic
955706878 3:61737011-61737033 AGCTGGTGTTGGGGAGAAGTGGG - Intronic
955741539 3:62096073-62096095 GAGTTGAGCTGGAGAGAAGTAGG + Intronic
955977723 3:64494190-64494212 GGGTGATGTTGGAGAAAGGTGGG - Intergenic
956331336 3:68113291-68113313 AGGTGGTGCTGCAGAGAAGTAGG + Intronic
956678433 3:71755332-71755354 GGGTGGGGTGGGTGAGGAGTAGG + Exonic
956978561 3:74610776-74610798 GGGTGAACATGGAGGGAAGTGGG + Intergenic
957157709 3:76566725-76566747 GGGTGGAGAGGAAGAGAAGTGGG + Intronic
957699901 3:83695377-83695399 GTGGGGTGTTGGGGAGAAGTAGG + Intergenic
957917032 3:86698572-86698594 GGGAGGACTGGGAGAGAAGCAGG - Intergenic
958811526 3:98865464-98865486 GGGATGAGCTGGAGAGATGTTGG + Intronic
958958777 3:100489436-100489458 TGGTGGAGTAGGAGGCAAGTAGG - Intergenic
958978795 3:100696975-100696997 GGGTGGTGTGGCAGAGAAGGAGG + Intergenic
959470683 3:106745970-106745992 GGATGGAGTTTGAGAGTAGACGG + Intergenic
959629270 3:108490163-108490185 AGGTTGAGGTGGAGAGAAGGTGG + Intronic
959760307 3:109955262-109955284 GAGAGGAGATGGAGAGAAGTTGG - Intergenic
960454778 3:117857284-117857306 AGTTGGAGATGGAGAGAAGTAGG - Intergenic
960537036 3:118826034-118826056 TGGTGGAAATGGAGAGAAGGAGG + Intergenic
960786027 3:121373515-121373537 GGGTGGATGTGGAGGGATGTTGG - Intronic
960807553 3:121598674-121598696 TGGTGGAGATGGAAAGAAGTGGG + Intronic
961120972 3:124369727-124369749 CGGGGGAGTTGGGGAGATGTTGG - Intronic
961372453 3:126439963-126439985 GGGAGGAGCTGGAGAGCAGAAGG - Intronic
961615364 3:128175188-128175210 GGGTTGACTTGGAGAAAAGGGGG - Intronic
962241086 3:133751564-133751586 GGCTGGAGTGGGGGAGAAATAGG + Intronic
962396633 3:135020420-135020442 GGGAGGAGTTGAAGTGAAATGGG - Intronic
962865917 3:139447991-139448013 GGGTAGAGGAGGAGAGAAGATGG - Intergenic
962925028 3:139985028-139985050 CAGTGGAGATGGAGAGAAATGGG - Intronic
963190870 3:142471867-142471889 GTGAGGAGTTGGGGAGATGTTGG - Intronic
963411839 3:144938025-144938047 GGGTGGAGTTGGGGGAAGGTGGG + Intergenic
963422786 3:145082411-145082433 GGGTGGAGTTGGAGAGTCAAAGG + Intergenic
963638431 3:147828653-147828675 CAGTGGAGATGGAGACAAGTAGG + Intergenic
964747050 3:160022297-160022319 AGGTCGAGTAGGAGAGACGTCGG - Intronic
964764148 3:160162319-160162341 GGGAGAAGTTGGAGAGAAGATGG + Intergenic
964873083 3:161334623-161334645 GGTGGGATCTGGAGAGAAGTGGG + Intergenic
964874107 3:161346833-161346855 GGTTGGAGGTGGGAAGAAGTAGG + Intronic
964892234 3:161551220-161551242 GGGTGCAGTGGGAGACAAGAGGG - Intergenic
965072646 3:163935307-163935329 GTGTGCAGTTAGACAGAAGTTGG - Intergenic
965316218 3:167193979-167194001 GGGGGAAGTTGAAGAGAGGTTGG + Intergenic
965915248 3:173837826-173837848 CAGTGCAGTTGGAGGGAAGTGGG + Intronic
965965961 3:174489812-174489834 TGGTGAAGTTGTAGAGAAATGGG + Intronic
965965971 3:174489910-174489932 TGGTGAAGTTGTAGAGAAATGGG + Intronic
966504464 3:180684017-180684039 CAGTGGAGATGGAGAGCAGTAGG - Intronic
967198073 3:187046618-187046640 GGATGGAGTTTGAGGGATGTTGG + Intronic
967844747 3:194034773-194034795 GACTGGATTTGGAGGGAAGTAGG + Intergenic
968292671 3:197550740-197550762 GGGTGGAGGTGGAGGGAGGGAGG + Intronic
968359932 3:198139700-198139722 AGGAGGAGTTGGGGAGAAGGAGG + Intergenic
968850725 4:3075574-3075596 GTTTGGAGCTGGAGAGATGTGGG + Intronic
969133553 4:5011321-5011343 GGGTGGATTTGGAGGGAGGGAGG + Intergenic
969328774 4:6460937-6460959 GGGTGGAGTGGGAGAGGAGCTGG - Intronic
969392360 4:6900413-6900435 ATGTGGGGTTGGAGAGAAGTGGG + Intergenic
969911557 4:10451853-10451875 GGCTGAACTTTGAGAGAAGTGGG - Intronic
970053044 4:11937963-11937985 GAGTGGAGTTTGGGAGATGTTGG + Intergenic
971429267 4:26547079-26547101 TGGTGGAGGTAGAGAGAAGGAGG - Intergenic
971503759 4:27344266-27344288 GGGGGGAGTTGAAGGGAAGGGGG - Intergenic
972273533 4:37535545-37535567 AGGTAGAGGTGGAGCGAAGTGGG - Intronic
972346775 4:38198928-38198950 GGGGGGAGGTGGCGTGAAGTTGG + Intergenic
972351685 4:38242155-38242177 GGCTGGGGGTGGAGTGAAGTAGG - Intergenic
972358455 4:38304062-38304084 GGGTGGAGAGGGAGGGAAATGGG + Intergenic
972602211 4:40582624-40582646 GGATGGAGTTGGAGTGAGGCAGG - Intronic
973386084 4:49515213-49515235 GGGTGTGGTTGGAGAGTAGCTGG - Intergenic
973587268 4:52405872-52405894 GGGTGCAGTGGGAGATAAGAAGG + Intergenic
975294289 4:72714547-72714569 GGTTGGTGTTGGGGAGATGTTGG - Intergenic
975472203 4:74782733-74782755 TGGTGGAGTTGCAGAGAAAAGGG - Intronic
975955346 4:79830606-79830628 GGGTGGAGAAGGAAGGAAGTAGG - Intergenic
976491161 4:85672208-85672230 GAGTGGAGTTGGAATGAACTAGG + Intronic
976830023 4:89305301-89305323 GGGTAGAGGTGGAGAGAATAAGG - Intronic
976972900 4:91129378-91129400 GGGTTGTGTTAGAAAGAAGTTGG + Intronic
977007367 4:91586026-91586048 GGATGGAGGTGGAGAGTAGTGGG + Intronic
978062842 4:104359332-104359354 GGTGGGTGTTGGAGGGAAGTGGG + Intergenic
978421288 4:108535869-108535891 GGGTGGAGAAGGAAGGAAGTTGG - Intergenic
979476568 4:121165257-121165279 GGGGAGAGTTGGAGAGTAGGGGG - Intronic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
980481700 4:133395710-133395732 GGTTGTAGGTGGAGAGAAGGAGG + Intergenic
980991903 4:139745390-139745412 GGCTGGATCTGGAGAAAAGTGGG + Intronic
981917539 4:150051424-150051446 CAGTGGAGGTAGAGAGAAGTGGG - Intergenic
982227017 4:153175550-153175572 GGGTGGAGTTGAATAGCAGGAGG + Intronic
982590680 4:157305352-157305374 GGGTGGAACTGGAGAGATGAGGG - Intronic
982852199 4:160332722-160332744 AGGTGGGGGTGAAGAGAAGTTGG - Intergenic
983669866 4:170223765-170223787 GGGAGGAGATGGTGAGAGGTTGG + Intergenic
983907326 4:173197734-173197756 GGCTGTGGTTGGAGAGAAGTGGG + Intronic
984675125 4:182538698-182538720 TAGTGGAGTTGAAGAGAAGTGGG + Intronic
984758570 4:183345023-183345045 GTGGAGAGGTGGAGAGAAGTGGG + Intergenic
984783582 4:183548087-183548109 GGGAGGAGATGGAGAGATGTTGG - Intergenic
984823355 4:183903849-183903871 GGGTAGGGTTGGAGAGCAGAAGG + Intronic
984837282 4:184033663-184033685 TGGTGGAGCTGGAGATAAGTGGG - Intergenic
985614067 5:909057-909079 GGGTGGGATAGGAGAGAAGTGGG - Intronic
985778177 5:1856299-1856321 GGGGAGAGATGGAGAAAAGTAGG + Intergenic
986092406 5:4523262-4523284 GGGTGGTGATGGCGAGAAGTGGG + Intergenic
986639349 5:9857155-9857177 AGGAGGAGATGAAGAGAAGTTGG + Intergenic
986908343 5:12522207-12522229 GGGTGGGGTGGGGGAGCAGTGGG + Intergenic
987001542 5:13664868-13664890 GGGAAGAGTTGGAGAGAGGAAGG + Intergenic
987544435 5:19294633-19294655 GGGTGGAGATGAAGAGAGATTGG - Intergenic
988156097 5:27450820-27450842 AGGAGGAAATGGAGAGAAGTAGG + Intergenic
988609429 5:32711195-32711217 GGGTGGGGGTGGGGAGATGTGGG - Intronic
989132454 5:38121096-38121118 GGCTGGAGAAAGAGAGAAGTTGG - Intergenic
989187617 5:38640408-38640430 GGGTGGGGCTTGAGAGAAGAAGG - Intergenic
990842014 5:60092301-60092323 GGGAGGAGATGAAGAGAATTTGG + Intronic
990871763 5:60439718-60439740 CAGTGGAGATGGAGAGAGGTGGG - Intronic
991166796 5:63572392-63572414 GACTGGAGTTGGTGAGAAGCTGG + Intergenic
991353034 5:65738695-65738717 GGAGGGAGTTGGAGAGATGCTGG - Intronic
991707102 5:69369213-69369235 GGGGGGGGGTGGAGAGAGGTCGG - Intronic
992525111 5:77602091-77602113 GGGTGGGGATGAAGAGAGGTTGG - Intronic
992590088 5:78285847-78285869 TGGTGGTAGTGGAGAGAAGTGGG - Intronic
992998382 5:82355082-82355104 GTGTGGGGTTGGGGGGAAGTTGG + Intronic
993400021 5:87438120-87438142 GGGTGGAGTTGGGGAAATGTTGG - Intergenic
993876095 5:93308765-93308787 GGGTGGACTTGGAGAGAGGAAGG + Intergenic
994790912 5:104224336-104224358 GGCAGGAGCTGGAGAAAAGTGGG - Intergenic
994793125 5:104257779-104257801 GGGTGGGGTGAGACAGAAGTGGG + Intergenic
995592184 5:113711224-113711246 GGGTGGCATTGGAGAGATATTGG - Intergenic
996139508 5:119888708-119888730 CTGTGGAGTTGGAGAGTAGTGGG + Intergenic
996285328 5:121784287-121784309 CAGTGGAGATGGAGAGACGTGGG + Intergenic
997292882 5:132750000-132750022 GGGAGAAGTTGGAGGGAGGTAGG - Intronic
997448740 5:133964409-133964431 GGGTGAGGTAGGAGGGAAGTGGG + Intronic
997612538 5:135225155-135225177 TTGTGGAGTCAGAGAGAAGTTGG + Intronic
997834948 5:137184744-137184766 TGGAGGAGTTGGAGAGAGGCTGG - Intronic
998192834 5:140042184-140042206 GGTTGGGGTTGGAGAGAAGAAGG - Intronic
998531738 5:142891218-142891240 GGGTGGTGGTGGTGAGAAGCAGG + Intronic
998636260 5:143958268-143958290 TGATGGGGTTGGAGAGAAGGGGG + Intergenic
999054301 5:148557255-148557277 CTGGGGAGATGGAGAGAAGTGGG + Intronic
999363511 5:151006216-151006238 GGGTGGGTTTGGAGAGCAGGAGG - Intergenic
999675724 5:154000213-154000235 GGGTGGGGATGAAGAGAAGTTGG + Intronic
999798513 5:155010630-155010652 GGGAGGAGGAGGATAGAAGTAGG - Intergenic
1000210727 5:159104406-159104428 GGGTTGAGGTGGAGAGGAGCAGG + Intergenic
1000490563 5:161907381-161907403 GGGTGTGGTTGGGGAGATGTTGG + Intergenic
1000644353 5:163742795-163742817 GGGTGGAGGTTGAAAGAACTAGG + Intergenic
1000993555 5:167935620-167935642 AGGTGGTGAAGGAGAGAAGTTGG + Intronic
1001004884 5:168041438-168041460 GAGTGGAGTTAGTGAGAAGGAGG - Intronic
1001665206 5:173427114-173427136 GGGAGGAAAAGGAGAGAAGTAGG + Intergenic
1001721426 5:173860098-173860120 GGATGAAGTTGGACAGAGGTTGG + Intergenic
1001848254 5:174940497-174940519 GGATGGAGATGGAGAGAAGGAGG + Intergenic
1002187687 5:177462176-177462198 GGGTGGTGTTGGAGAGGTGACGG - Intronic
1002213263 5:177610688-177610710 GGGAGGAGAAGGGGAGAAGTGGG + Intergenic
1002606404 5:180385367-180385389 CGGTGGAGATGGGGAGAAGATGG + Intergenic
1002805173 6:567009-567031 CAGTGGAGTTGGAGAGCAGTTGG - Intronic
1002830677 6:817628-817650 GGGAGGGGTTGGGTAGAAGTTGG - Intergenic
1002851853 6:1003643-1003665 GTGTGGATGTGGAGAGAGGTGGG - Intergenic
1003098527 6:3159742-3159764 GGGTGGGGGTGGGGAGAAGGTGG - Intergenic
1003263557 6:4546808-4546830 GTGTGGACTTGGAGGGAAGGGGG + Intergenic
1003448192 6:6204611-6204633 GGGAGTTGTTGGAAAGAAGTGGG + Intronic
1003693670 6:8380062-8380084 GGGTGAGGCTGGGGAGAAGTTGG + Intergenic
1003803538 6:9699763-9699785 GGGTGGAGTCAGAGAGAGCTGGG - Intronic
1004189014 6:13447993-13448015 GGGTGGATTTGGAGGGAGGAGGG + Intronic
1004446056 6:15699769-15699791 GGGTGCATTTGGAAAGAAGCGGG + Intergenic
1004488947 6:16095525-16095547 GGGTGGACAAGGAGAGAAGAGGG - Intergenic
1004655796 6:17659043-17659065 GGGTGTTGTTGTAGAGAAGTAGG - Intronic
1004700977 6:18079132-18079154 GGGTAGAGGAAGAGAGAAGTGGG + Intergenic
1005302930 6:24488855-24488877 GGCAGGAGTTGGAGAGCAGAAGG - Intronic
1005512601 6:26524555-26524577 GGTTGGTGGTGGAGAGGAGTTGG + Intergenic
1006207888 6:32365571-32365593 GGGTGGAGTGAGAAATAAGTGGG + Intronic
1006412852 6:33885388-33885410 TGGTGGAGTAGGAGGGAAGAGGG - Intergenic
1006566575 6:34963264-34963286 GGGTGATGTTGGGGAGATGTTGG - Intronic
1006627590 6:35408387-35408409 GAATGGAGCTGGGGAGAAGTAGG + Intronic
1006945051 6:37779320-37779342 GGGTGGAGGGGGAGGGAAGAAGG + Intergenic
1006956488 6:37878042-37878064 AGCAGTAGTTGGAGAGAAGTAGG + Intronic
1007278507 6:40693061-40693083 GGGTGGTGTTAGAGAGCAGGAGG - Intergenic
1007533551 6:42564301-42564323 GGGAGGAGGAGGAGAGAAGATGG + Exonic
1007770633 6:44189319-44189341 GGATGGAGTTGCAGTGAAGTTGG - Intergenic
1007821722 6:44565278-44565300 GAGTAGACTTGGAGAGAAGAGGG - Intergenic
1007823704 6:44581450-44581472 GGGTCGGGGTGGAGAGAATTTGG + Intergenic
1008687178 6:53938428-53938450 GGGTTGTGTGGGAGAGGAGTGGG + Intronic
1008966491 6:57317855-57317877 GGGAGGAGTTGGGGAGAGATAGG + Intronic
1009298893 6:61989917-61989939 GGGTGGGGTTGGGGAGGAATTGG + Intronic
1010126878 6:72442775-72442797 TGGGGGCGTTGGAGACAAGTCGG - Intergenic
1010788415 6:80033115-80033137 GGCTGGAGGTTGAGAGAAATGGG - Intronic
1011249921 6:85360295-85360317 CTGAGGAGCTGGAGAGAAGTTGG + Intergenic
1011574072 6:88775377-88775399 TGGGGGAGTTGGGGAGATGTAGG - Intronic
1012733119 6:102906817-102906839 GGGTGGAGTTAGTGAGAATTTGG - Intergenic
1012928320 6:105290437-105290459 GGGGGTAGTTGGAGGGAATTCGG - Intronic
1013030158 6:106325351-106325373 AGGTGGAGTTGGCGAGACGCCGG - Intronic
1014390732 6:120859524-120859546 GGGTGGTGTTGGGGGGATGTTGG - Intergenic
1014589867 6:123250896-123250918 GTGTAGTGTTGGAAAGAAGTGGG - Intronic
1015173751 6:130283299-130283321 AGGTGGTGTTTGAGAGAAGAGGG + Intronic
1015510222 6:134031040-134031062 GAGTGGAACTGGAGATAAGTAGG + Intronic
1015857832 6:137644569-137644591 GGGGGGAGATGAAGAGAAATGGG - Intergenic
1016039835 6:139421501-139421523 GGGTGGAAAGGGAGAGCAGTAGG - Intergenic
1016227847 6:141762073-141762095 GGGGAGAGTTGGAGAGGGGTGGG + Intergenic
1016342032 6:143073011-143073033 GGGAGGAAATGGGGAGAAGTAGG - Intronic
1016604726 6:145907295-145907317 CGGTAGAAATGGAGAGAAGTGGG - Intronic
1017203437 6:151779534-151779556 TGGTGAAGTTGCAGAGAAATAGG + Intronic
1017204283 6:151788460-151788482 TGGTGAAGTTGCAGAGAAATGGG + Intronic
1017296644 6:152803819-152803841 GTGTGGAGTCGGAGAGATGGGGG + Intergenic
1017425083 6:154312317-154312339 GGGAAGGATTGGAGAGAAGTTGG + Intronic
1018418470 6:163621565-163621587 TGGAGGAGTTGGAGAAGAGTGGG - Intergenic
1018479432 6:164174933-164174955 GGGTGGAGTTGGGGATCATTAGG + Intergenic
1019772565 7:2892999-2893021 GGGTGGGGCTGGAGAGAAGCAGG + Intergenic
1020127454 7:5541028-5541050 GGGTGGAGAAGGAGAGAAAAGGG + Intronic
1020382820 7:7565670-7565692 GAGTGGGCATGGAGAGAAGTGGG - Intergenic
1020650953 7:10875658-10875680 AGGTGGGGTTGGGGAGATGTTGG - Intergenic
1020654394 7:10912171-10912193 CAGTGGAGGTGGAGAGAAGAGGG - Intergenic
1020718209 7:11705585-11705607 AGTTGGAGGTGGAGGGAAGTAGG + Intronic
1021627645 7:22610081-22610103 TAGTGGAGATGGAGAGAAGTTGG - Intronic
1021768471 7:23973064-23973086 GGGGAGAGTTGGGGAGATGTTGG - Intergenic
1022394064 7:29969986-29970008 CAGTGGAGGTGGAGAGGAGTGGG - Intronic
1022632082 7:32094814-32094836 AGATGGAGCTGGAGAGAAGGTGG - Intronic
1022638213 7:32157203-32157225 GAGGGGGGTTGAAGAGAAGTTGG - Intronic
1022729620 7:33010221-33010243 CTGTGGAACTGGAGAGAAGTGGG - Intergenic
1022865414 7:34413673-34413695 GGGAGAAGTGGGAGGGAAGTAGG - Intergenic
1022922727 7:35032883-35032905 CTGTGGAGATGGAGAGAAATTGG - Intronic
1023083653 7:36548534-36548556 GAGTGGAGTTGGTGAGGAGAGGG + Intronic
1023215758 7:37861018-37861040 AGGTGGAGGTGGAGAGATGACGG - Intronic
1023456281 7:40342149-40342171 TGGCTGAGTTGGAGAGAAGATGG - Intronic
1023484930 7:40676061-40676083 GGATGGGGTTGGGGAGATGTGGG + Intronic
1023810381 7:43906690-43906712 GGGTGGAGGTGGGGTGAGGTGGG + Exonic
1024046223 7:45587432-45587454 CGGTGGGGTTAGAGAGAAGTTGG + Intronic
1024097258 7:45992343-45992365 GGGTGGAGGTAGGAAGAAGTAGG - Intergenic
1024213748 7:47228858-47228880 GGCTGGAGGAGGAGAGAGGTGGG - Intergenic
1024245663 7:47468020-47468042 GTCTGCAGTTGGAGAGAAGTTGG - Intronic
1024256855 7:47545881-47545903 GGGTGGAGTTTGTGTGATGTCGG - Intronic
1024481892 7:49872226-49872248 GGGTGGAGGTGGAGAGACAGAGG + Intronic
1024632595 7:51262045-51262067 GGATGGAGCTGGAGAGGGGTGGG + Intronic
1024657514 7:51464206-51464228 GGATGGAGATGGAGAGAAGTGGG + Intergenic
1024743791 7:52384342-52384364 AGGTAGAGTTGGATAGAATTAGG + Intergenic
1025764583 7:64430842-64430864 GGGGGGGGTTGGGAAGAAGTGGG + Intergenic
1026466669 7:70660436-70660458 GCGTAGATTTGGAGAGAAGAAGG + Intronic
1026494050 7:70887778-70887800 AGGAGGAGGAGGAGAGAAGTGGG + Intergenic
1027649121 7:80843060-80843082 GGGTGCAGATAAAGAGAAGTTGG + Intronic
1027732429 7:81891800-81891822 GGGGAGAGATGGAGAGATGTTGG + Intergenic
1028028986 7:85884874-85884896 AGGAGGAGTTGGAGACAGGTTGG + Intergenic
1028086609 7:86644548-86644570 GGGTGGAGTAGAAGAGAGGGAGG - Exonic
1028602928 7:92622114-92622136 GAGTGGAGTAGGAAAAAAGTGGG - Intronic
1030606880 7:111646992-111647014 GGTTGGGGTTGGTGAGAAGATGG + Intergenic
1030704561 7:112678091-112678113 AGATGGAGATGGAGAGAACTGGG + Intergenic
1031502191 7:122532519-122532541 GGGTGGGGGTGGGGAGAGGTCGG - Intronic
1031838570 7:126708828-126708850 GGGAGCAGTTGGGGAGATGTTGG + Intronic
1031895040 7:127338730-127338752 GGGTGCCGTTGGGGAGAAGATGG - Intergenic
1031923452 7:127617870-127617892 AGGCAGAGTGGGAGAGAAGTTGG + Intergenic
1032184977 7:129716918-129716940 GAGAGGAGTTGGAAACAAGTTGG - Intronic
1032610617 7:133408402-133408424 TGATGGAGGTGGAGAGAGGTTGG + Intronic
1032703174 7:134399518-134399540 GGGTGGAGGGAGAGAGAGGTTGG - Intergenic
1032728708 7:134616304-134616326 GAGTGAAGTTAGAGAGAAGGTGG + Intergenic
1032792704 7:135254029-135254051 AGATGGACTTGGGGAGAAGTGGG + Intronic
1032853623 7:135816169-135816191 TGGTTGAGATGCAGAGAAGTGGG + Intergenic
1033227087 7:139570933-139570955 GGATGGAGGTGTGGAGAAGTGGG - Exonic
1033460885 7:141546642-141546664 GGGGGAGGTTGGGGAGAAGTGGG - Intergenic
1034416220 7:150965587-150965609 GGGAGGAGTTGGAGGGAAGAGGG - Intronic
1034503495 7:151467489-151467511 GGGTGGAGTGGGACAGGAGATGG - Intronic
1034697249 7:153064707-153064729 GGGTGGAGGTGGAGATGGGTGGG - Intergenic
1035903083 8:3478996-3479018 GGGTGGGCTTGGGGAGATGTTGG - Intronic
1036659092 8:10696237-10696259 GGGGAGAGGAGGAGAGAAGTGGG + Intronic
1037456185 8:19066566-19066588 CTGTGGAGTAGAAGAGAAGTTGG - Intronic
1038097968 8:24336732-24336754 GGGAGGAGGTGGGGAGATGTTGG + Intronic
1038497638 8:28015082-28015104 GGGTGGAGGAGGGGAGAAATGGG - Intergenic
1038705622 8:29890831-29890853 TGGTGAAGTTGCAGAGAAATAGG - Intergenic
1038946445 8:32366326-32366348 GGGGGCAGATGAAGAGAAGTTGG - Intronic
1039398162 8:37245144-37245166 TGGTGGAGATGGAGAGCAGCAGG + Intergenic
1039859314 8:41443118-41443140 TGGTGAAGTTGCAGAGAAATAGG - Intergenic
1039892993 8:41697086-41697108 GGGCAGAGCTGGAGAGAAGGGGG - Intronic
1039913526 8:41843379-41843401 GGGGGGAAATGAAGAGAAGTGGG - Intronic
1040295115 8:46145050-46145072 GGGTGGAGTGGGAGGGACGCAGG - Intergenic
1040549335 8:48426668-48426690 GGTGGGAGTTGGAGAGAGGAGGG - Intergenic
1041494868 8:58474750-58474772 GGGTGGAGATGGGGAAATGTTGG - Intergenic
1041523463 8:58779736-58779758 AGGTGGAGATGAAGAGAAGTAGG - Intergenic
1041687905 8:60661084-60661106 GGTTGGAGATTCAGAGAAGTCGG - Intergenic
1041896202 8:62927101-62927123 GGAAGGAGTATGAGAGAAGTTGG - Intronic
1042081996 8:65064457-65064479 GGGTGGTGTGGGACAGAAGTGGG - Intergenic
1042323176 8:67499637-67499659 GGGTGGAGTTGGAAGGAAAGTGG - Intronic
1043372558 8:79611709-79611731 GGGAGGGGATGGAGAGAACTGGG + Intronic
1043426908 8:80156854-80156876 GGGTAGAGTAGAAGAGAATTGGG + Intronic
1043426914 8:80156875-80156897 GGGTCGGGTTGAAGAGGAGTGGG + Intronic
1043427081 8:80158261-80158283 GGTTGGGGTTGAAGAGGAGTGGG - Intronic
1043427087 8:80158282-80158304 GGGTGGAGTTGAGGAGAATTGGG - Intronic
1044426231 8:92054042-92054064 GGGTGGGGTGGGGAAGAAGTGGG + Intronic
1044565723 8:93659489-93659511 GTGTGGAGCTGTAGAGATGTGGG + Intergenic
1044824509 8:96183580-96183602 GGGAGGAGGTGGAGAGAGCTGGG - Intergenic
1045805486 8:106156049-106156071 GGGTAGAGTTGAAGAAAGGTTGG - Intergenic
1046091980 8:109513813-109513835 CAGTGGAGGTGGTGAGAAGTGGG - Intronic
1046120858 8:109844981-109845003 GAGTGGAGATGAAGAGAGGTTGG - Intergenic
1046256070 8:111697439-111697461 GTGTAGAGTTGGGGAGAAGAGGG + Intergenic
1046428363 8:114086237-114086259 TTATGGAGTAGGAGAGAAGTGGG - Intergenic
1046781318 8:118218509-118218531 GGGTGGGGGTGGGGAGATGTTGG - Intronic
1047030921 8:120879833-120879855 CAGTGGACCTGGAGAGAAGTTGG + Intergenic
1047089736 8:121560440-121560462 GGTTGGAGTTGGGGGGAAGGAGG + Intergenic
1047646902 8:126879062-126879084 GGATGGGGTTGGAGGGGAGTGGG - Intergenic
1047651211 8:126924460-126924482 GAGGGGAGTTGGTGAGGAGTGGG - Intergenic
1048020173 8:130531071-130531093 GGGTTGAAGTGGAGAGGAGTAGG + Intergenic
1048039137 8:130708070-130708092 TGGTGGAGTGGGAGAGAAAGAGG + Intergenic
1048190204 8:132281580-132281602 AGGTGGAGATGGAATGAAGTAGG - Intronic
1048334025 8:133489966-133489988 GGAGTGAGTTGGAGAGAAGGAGG - Intronic
1048516564 8:135116778-135116800 GGGAGGAGGAGGAGAGAAGAAGG - Intergenic
1048584189 8:135757267-135757289 TGGGGGAGTTGGAGAGGGGTGGG + Intergenic
1048958155 8:139554038-139554060 GGGTGAAGTTGGTGAGAATGAGG - Intergenic
1049064035 8:140298974-140298996 GGTTTGAGCTGGAGAGAAGCTGG + Intronic
1049129727 8:140827547-140827569 GGGTGGGGATGGAGAGCAGTAGG + Intronic
1049144509 8:140988787-140988809 AGGTGGCGCTGCAGAGAAGTAGG + Intronic
1049296876 8:141845478-141845500 GGGTGGGGTGGGGGAGAAATGGG - Intergenic
1049609922 8:143550146-143550168 AGGTTGGGCTGGAGAGAAGTGGG - Intergenic
1049663930 8:143834785-143834807 GAGTGGAGTGGGAGAGAGGCAGG + Exonic
1049689392 8:143952053-143952075 GGGGGGAGTGGGAGAGAGGGGGG + Intronic
1049716752 8:144096513-144096535 GGGTGGTGCTGGAGAGATGGGGG + Intronic
1050135850 9:2463286-2463308 TGGTGAAGTTGTAGAGAAATGGG - Intergenic
1050730982 9:8709103-8709125 GGGAGGGGTTGGGGAGATGTTGG + Intronic
1050866029 9:10500677-10500699 GGGAGGGGTTGGGGGGAAGTTGG - Intronic
1050947001 9:11536017-11536039 ATGGGGAGATGGAGAGAAGTTGG + Intergenic
1051320152 9:15894561-15894583 TGATGGAGTTGGAGAGCAGCAGG - Intronic
1051627631 9:19113497-19113519 GAGTTGAGTTGGAGAGTAGGTGG - Intronic
1052395154 9:27929504-27929526 GGGTGGGGGTGGAGGGAAGGAGG + Intergenic
1052420127 9:28233627-28233649 TGCTGGAGTTGGAGAGGAGATGG - Intronic
1052658547 9:31398245-31398267 AGGGGGAGATGAAGAGAAGTTGG - Intergenic
1053056743 9:34997438-34997460 GGGGGGAGTGGGAGGGAGGTGGG + Exonic
1053065426 9:35065503-35065525 GGGTGGAGTTGGGGAGAGGTAGG - Intronic
1053413673 9:37932400-37932422 GGGAGGAGATGGGGAGATGTAGG + Intronic
1053463904 9:38291016-38291038 GAGTGGAATTGGAGTGATGTGGG + Intergenic
1054867958 9:70022277-70022299 GGGTGGAGTTGCAGTGCAGCTGG + Intergenic
1055789652 9:79910188-79910210 AGGTGGAATTGCAGAGAAGCCGG - Intergenic
1056605873 9:88084426-88084448 GGGGTGAGTTGCAGAGAAGAAGG + Intergenic
1056723233 9:89089412-89089434 GGGTGGAGCAGGAGGGAACTGGG + Intronic
1056926710 9:90840395-90840417 GGGTGGAGTGGGGGAAAAGCAGG + Intronic
1057001260 9:91512119-91512141 TGGTGAAGTTGCAGAGAAATAGG + Intergenic
1057778798 9:98033430-98033452 GGGTGGGGCTGGAGGGAAGTGGG + Intergenic
1057809150 9:98244226-98244248 GGCTGGAGTTGGAGAGTTGCAGG + Intronic
1058083727 9:100726579-100726601 GGGTTGAGTAGGGGAAAAGTGGG - Intergenic
1058349287 9:104002125-104002147 GGTTGGTGGTGGAGAGGAGTTGG + Intergenic
1058366355 9:104213797-104213819 GGGTGGGAATGGGGAGAAGTTGG - Intergenic
1058506313 9:105669758-105669780 GGGTGGAGTTGGAGGCAGGAAGG - Intergenic
1059946414 9:119412843-119412865 GGATGGGGTTGGAGAGAGGAGGG + Intergenic
1059974585 9:119701973-119701995 GGGTGGTGGTGGAGGGAATTGGG + Intergenic
1060152656 9:121298810-121298832 GGTTGGAGTAGGTGGGAAGTAGG + Intronic
1060157300 9:121328776-121328798 GGGAGGAGAGGGAGAGCAGTTGG + Intronic
1060260029 9:122066370-122066392 GGGTGGAGTGGGAGACAACAGGG + Intronic
1060273414 9:122164251-122164273 GGGAGGAGAAGGAGAGAAGGAGG + Intronic
1060442866 9:123657405-123657427 GGGGGGAGTTGGAGTGGGGTGGG + Intronic
1060991659 9:127853256-127853278 GTGGGGAGGTGGGGAGAAGTTGG + Intronic
1061133890 9:128722624-128722646 GGGTGGGGTTGGGGTGCAGTTGG + Intronic
1061390342 9:130314227-130314249 GAGGGGAGTTGGGGAGAAATGGG + Intronic
1061612634 9:131757731-131757753 GGCAGGAGTGGGAGAGAAGTGGG + Intergenic
1062145667 9:134988437-134988459 GGGGGCAGATGGAGGGAAGTTGG - Intergenic
1203698769 Un_GL000214v1:118912-118934 GGGCGTAGTTGGAGAGTAGCTGG + Intergenic
1203700620 Un_GL000214v1:131202-131224 GGGCGTAGTTGGAGAGTAGCTGG + Intergenic
1203701584 Un_GL000214v1:137512-137534 GGGCGTAGTTGGAGAGTAGCTGG + Intergenic
1203480421 Un_GL000224v1:6096-6118 GGGCGTAGTTGGAGAGTAGCTGG + Intergenic
1203482352 Un_GL000224v1:18733-18755 GGGCGTAGTTGGAGAGTAGCTGG + Intergenic
1203568488 Un_KI270744v1:110924-110946 GGGCGTAGTTGGAGAGTAGCTGG + Intergenic
1203570010 Un_KI270744v1:121447-121469 GGGCGTAGTTGGAGAGTAGCTGG + Intergenic
1186234787 X:7496028-7496050 GGGTGGATTTGGTGAGCGGTTGG + Intergenic
1186276504 X:7944822-7944844 GGGTGGGGTGGGAGATAGGTGGG - Intergenic
1186657351 X:11629133-11629155 TGGTGGAGATGGAGGAAAGTAGG - Intronic
1187498287 X:19814832-19814854 GGATGGAGGAAGAGAGAAGTGGG - Intronic
1187885436 X:23884643-23884665 GGGGGGAGTTGGGGAGATATTGG + Intronic
1187918437 X:24177533-24177555 TGGTGGAGGTTGAGAGTAGTTGG - Intronic
1188003822 X:25004419-25004441 TGTTGGAGTTGGAGCGAGGTTGG + Exonic
1188272544 X:28158440-28158462 AGGTGAAGTTGGAGAGGAGCTGG - Intergenic
1188642121 X:32519327-32519349 TGGTGGGGGTGGAGAGTAGTTGG + Intronic
1188821560 X:34781449-34781471 GAGTGGTGTGGGAGAGGAGTTGG + Intergenic
1188931485 X:36116882-36116904 TGGAGGAGTGGGAGGGAAGTGGG - Intronic
1189214516 X:39311640-39311662 GGTGGGGGATGGAGAGAAGTGGG - Intergenic
1189633467 X:42979084-42979106 GGGTGGAGGTAGAGAGAATTAGG + Intergenic
1190258842 X:48785759-48785781 GGGTGGAGTGGGAGAGACAGAGG - Intergenic
1191059507 X:56279694-56279716 CAGTGGAGATGGAGAGAAGGAGG + Intronic
1191186536 X:57619216-57619238 CGGTGAAGTTGGGGAGAAATAGG + Intergenic
1191911774 X:66159337-66159359 CGGTGGAGATAGAGAGAAGTGGG + Intergenic
1193385677 X:80869039-80869061 GGGAGGAGTTGCAGAGAAAAAGG - Intergenic
1193397355 X:81001336-81001358 GGTTGGTGGTGGAGAGGAGTTGG - Intergenic
1194066090 X:89264304-89264326 TGTTGAAGTTGTAGAGAAGTGGG - Intergenic
1195242793 X:102968928-102968950 GGGATGGGTTGGGGAGAAGTTGG + Intergenic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1195431176 X:104791215-104791237 GGGTGGGGGTGGAGAGAGGAGGG - Intronic
1195722938 X:107884301-107884323 ACTTGGAGTTGGAGAGGAGTAGG + Intronic
1195756137 X:108200613-108200635 GGGGAGAGATGGAGAGAGGTTGG + Intronic
1196539697 X:116893187-116893209 GGGTAGAGTGAGAAAGAAGTTGG + Intergenic
1196539796 X:116894222-116894244 GGGTAGAGTGAGAAAGAAGTTGG + Intergenic
1196666547 X:118323179-118323201 TAGTGGACTTGGAAAGAAGTTGG - Intergenic
1197644882 X:129006498-129006520 GGGTGGGGTTGGGGAAAGGTGGG + Intergenic
1198090254 X:133321806-133321828 GGGTGGAGTTGAGGGTAAGTGGG - Intronic
1198249943 X:134870315-134870337 GGGTGAATGTGCAGAGAAGTGGG + Intergenic
1198281714 X:135149206-135149228 GGGTGCAGGTGGAGAATAGTTGG - Intergenic
1198289245 X:135223316-135223338 GGGTGCAGGTGGAGAATAGTTGG + Intergenic
1199284537 X:146041639-146041661 GGGTATAGATGGAGTGAAGTGGG + Intergenic
1199686702 X:150271591-150271613 CAGTGGAGGTGGAGACAAGTGGG + Intergenic
1199890341 X:152072712-152072734 GAGTGGAATTGGAAAGAAGCTGG + Intergenic
1200362678 X:155627211-155627233 GGGGGCAGGTGGAGAGATGTTGG - Intronic
1200720259 Y:6598424-6598446 TGTTGAAGTTGTAGAGAAGTGGG - Intergenic
1200945213 Y:8828811-8828833 TGGTAGAGATGGTGAGAAGTGGG + Intergenic
1202063177 Y:20909807-20909829 TGGTGGGTTTGGAGAGAAGGGGG + Intergenic
1202098871 Y:21284533-21284555 GTGTGGGGTTGGAGGGAGGTGGG - Intergenic