ID: 1081207702

View in Genome Browser
Species Human (GRCh38)
Location 11:40293902-40293924
Sequence TTCAAACCGAAGTGGATGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 76}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081207702 Original CRISPR TTCAAACCGAAGTGGATGGA AGG (reversed) Exonic
904145350 1:28386442-28386464 TTCAAACAGCAGTGGGTGAAAGG - Intronic
904181607 1:28669666-28669688 TCCAAACCTGAGGGGATGGAAGG + Intronic
917412577 1:174775114-174775136 TTCAAGCAAAAGTGGAGGGAAGG + Intronic
920317331 1:205086630-205086652 TTCAAATTGAAATGGATAGAAGG + Exonic
1064053764 10:12080344-12080366 TACAAACCCAAGTGCATGGGTGG + Intronic
1064834301 10:19508196-19508218 TTCAAAGAGTTGTGGATGGATGG + Intronic
1070286863 10:75089974-75089996 TTCAAACACAGGTAGATGGAGGG - Intergenic
1073501426 10:103941311-103941333 TTCATACATAGGTGGATGGAAGG - Intergenic
1079687512 11:23378529-23378551 TTTAAACAGAACTGGATGGCTGG + Intergenic
1080844623 11:36015804-36015826 TTGCAACCCAAGTGGGTGGAGGG - Intronic
1081207702 11:40293902-40293924 TTCAAACCGAAGTGGATGGAAGG - Exonic
1084521554 11:69666296-69666318 TTAAAACCAAAGTGGATTCATGG + Exonic
1088860792 11:113797431-113797453 TGAAAACCCAAGTGTATGGAGGG + Intergenic
1090612439 11:128483564-128483586 TTCAGACCGAAGGGGATGGGTGG - Intronic
1090903093 11:131049723-131049745 TGCAAACCATAATGGATGGATGG - Intergenic
1094059288 12:26296523-26296545 TTAAAACCGAGGTGGATGGTTGG + Intronic
1095253431 12:40005027-40005049 TTCAAACCCATGTTGTTGGAGGG + Intronic
1101175627 12:102147918-102147940 TTCTACCCAAAATGGATGGATGG - Intronic
1108701139 13:52945276-52945298 ATCAAATCGAACTGGATGGATGG + Intergenic
1109927446 13:69163009-69163031 TTGAAACGGAAGTGGGTGGGTGG - Intergenic
1112561293 13:100517133-100517155 TCCAAACCGGAGTGGAGGGAGGG + Intronic
1117314503 14:54560498-54560520 TTCAAACCTCAATGGATGAAGGG + Intergenic
1120710756 14:87790641-87790663 TTAAAAGCAAAGTGGGTGGAGGG + Intergenic
1120765921 14:88326363-88326385 GTAGAACCGAAGGGGATGGAGGG - Intronic
1120823630 14:88935507-88935529 CTCAAACCAGAGTGGCTGGAGGG - Intergenic
1122948597 14:105027216-105027238 TACTAACCTAAGAGGATGGATGG + Intergenic
1125978938 15:43982133-43982155 TTCACACAGAACTGTATGGAAGG - Intronic
1127882379 15:63169713-63169735 GTCATAGGGAAGTGGATGGATGG - Intergenic
1148921059 17:51034604-51034626 TTCAAACTGGACTGGAGGGAAGG + Intronic
1148934441 17:51153640-51153662 TTCAAACCTAAGCAGCTGGAAGG + Exonic
1153464791 18:5377465-5377487 TGCAAAATGAAGTTGATGGAGGG + Intergenic
1156941572 18:42773277-42773299 TTCAAACCAAAGGTAATGGAAGG + Intronic
1156999640 18:43509508-43509530 TTCATCCCCAAGTGGATGTATGG - Intergenic
1164303946 19:23987142-23987164 CCCAAACCCTAGTGGATGGAAGG - Intergenic
927632937 2:24790129-24790151 TTCAAACCCGAGTGACTGGAAGG + Exonic
935683656 2:105663182-105663204 TTAAAGCCAAAGTGAATGGAAGG - Intergenic
938728147 2:134124870-134124892 TTCAAACAGGAGTGGGTGGGTGG - Intronic
939116524 2:138067854-138067876 TTCAAAAGGAAGGGGATGGCAGG - Intergenic
940986144 2:160053928-160053950 TTAAACCCTAAGTGGAAGGAAGG + Intronic
943022626 2:182593446-182593468 TTCGAACAGTAGTGGATTGATGG - Intergenic
946531771 2:220578151-220578173 TTCCATCCTAAGTGGCTGGAGGG + Intergenic
1169591340 20:7146579-7146601 TTCAGCCCGAAGTTGCTGGAGGG - Intergenic
1174274497 20:49393867-49393889 ATCAACCAGAAGTGGCTGGAGGG + Intronic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1182742063 22:32575069-32575091 TTCAAACTGAATTCTATGGAGGG + Intronic
949943733 3:9174049-9174071 TTCAAAAGGAAGAGAATGGATGG + Intronic
953346164 3:42177824-42177846 ATCAAACAGGAGTGGATGGCAGG - Intronic
961008232 3:123419281-123419303 TTCAAAGAGAAGTGGGTGGGCGG - Intronic
961504042 3:127358454-127358476 TTCAAACCAAAGGGGAAAGATGG - Intergenic
963385261 3:144584750-144584772 TTCAAAGCAAAGTGTATGGTAGG - Intergenic
965646368 3:170885844-170885866 TGTAATCCGAAGCGGATGGATGG - Intergenic
972362676 4:38342853-38342875 TTCAAACCGATGTTGTTGAAGGG - Intergenic
972643658 4:40947835-40947857 TTCAATCAAAATTGGATGGATGG + Intronic
979684599 4:123497404-123497426 TTCAAAAAGAAGAGGATGGTTGG - Intergenic
980806746 4:137825244-137825266 TTGAAACCTAAGTGTATGGAAGG + Intergenic
981667712 4:147248336-147248358 AGCAAACAGAAGTGGATGGAGGG - Intergenic
983920891 4:173343303-173343325 TTCAAGGCCAAGAGGATGGAAGG - Intergenic
984658344 4:182344387-182344409 TTCAGAGGGAAGTCGATGGAGGG + Intronic
984666969 4:182439640-182439662 TTGAAAACCAAGTGGATGGTGGG - Intronic
986214566 5:5707333-5707355 TTCCAAGCGGATTGGATGGAAGG - Intergenic
989604641 5:43232364-43232386 TCCAGACGGAAGTGGATGGGGGG + Intronic
991062088 5:62387274-62387296 TTCAAAGGGAAGAGGAAGGATGG + Exonic
994442442 5:99826960-99826982 TTCAAACCGATGTTGTTTGAGGG - Intergenic
995935253 5:117503225-117503247 TTCACACAGGAGAGGATGGAAGG - Intergenic
1001352554 5:170983224-170983246 TTCAAACTGGAGCAGATGGAAGG + Intronic
1002130751 5:177080058-177080080 TCCAAACCAAAGTGGATGGAGGG - Intronic
1007572241 6:42901297-42901319 TTTAAACCGTGGTGGATCGATGG - Intergenic
1008693185 6:54004022-54004044 TTCTAACCGAAGTGGACAGTGGG + Intronic
1017391582 6:153945820-153945842 TTAAAAATCAAGTGGATGGATGG + Intergenic
1023782296 7:43668293-43668315 TACAAACCCATGTGGATGGCTGG + Intronic
1030787500 7:113680452-113680474 TTCAAACCGATGTTGTTGGAGGG + Intergenic
1035015425 7:155761799-155761821 ATCAAACCCAAGTAGAAGGAAGG - Intronic
1035592430 8:826410-826432 TTAAAACCAAAGTGAATGAAAGG - Intergenic
1035912954 8:3588471-3588493 TTCAAACAGAAAGGGAGGGATGG + Intronic
1039960528 8:42243634-42243656 TTCAAACCGAAGTGGCTTTATGG - Intergenic
1040707231 8:50143972-50143994 TCCATACCGAGGTTGATGGAAGG - Intronic
1043098026 8:76000347-76000369 TATAAACCGATGTGGATGGACGG - Intergenic
1046344934 8:112911077-112911099 TTGAAACAGAAGTGAATTGAGGG - Intronic
1048264878 8:132976858-132976880 ATCAAACAGAAGTGGGTGGTGGG + Intronic
1050266682 9:3898167-3898189 TTCAAACCTAGGCAGATGGAAGG + Intronic
1055025132 9:71711492-71711514 TTCAACCTCAATTGGATGGATGG - Intronic
1055620907 9:78124277-78124299 GACAAACCCACGTGGATGGATGG + Intergenic
1061796588 9:133088935-133088957 TTCAAACCGAAGCAGAGGGATGG - Intergenic
1190212685 X:48460551-48460573 TGGAAACAGGAGTGGATGGATGG - Intronic
1192218368 X:69179683-69179705 TAAAAACCCAAGTGCATGGATGG - Intergenic
1192247384 X:69384955-69384977 TTTGAACTGAAGTGGATGAATGG - Intergenic
1196654742 X:118205943-118205965 TTCAAACGGCTGTGCATGGATGG + Intergenic
1198841642 X:140864002-140864024 TTTAAAACGTAGTGGATTGATGG + Intergenic