ID: 1081209008

View in Genome Browser
Species Human (GRCh38)
Location 11:40308903-40308925
Sequence ATGCATATGAATCATCAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 1, 2: 0, 3: 27, 4: 296}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081209007_1081209008 -9 Left 1081209007 11:40308889-40308911 CCAATAAAACGGACATGCATATG 0: 1
1: 0
2: 1
3: 24
4: 350
Right 1081209008 11:40308903-40308925 ATGCATATGAATCATCAGAATGG 0: 1
1: 1
2: 0
3: 27
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081209008 Original CRISPR ATGCATATGAATCATCAGAA TGG Intronic
905132642 1:35772530-35772552 ATGCATCAGAATAATCTGAAAGG + Intergenic
905153805 1:35956348-35956370 TTGCATAAGAAACATCAAAATGG + Intronic
906200456 1:43956914-43956936 ATCCATATTCCTCATCAGAAGGG - Exonic
906293313 1:44633823-44633845 ATGGACGTGAAACATCAGAAAGG - Intronic
907788030 1:57633276-57633298 ACGCATCTGAATAACCAGAAGGG + Intronic
910059299 1:83069160-83069182 ATGCATCAGAATCATCTGAAGGG - Intergenic
910992249 1:93068377-93068399 ATGCATCAGAATGATCTGAAAGG + Intergenic
911466307 1:98257787-98257809 ATAAATATGAATCCACAGAAAGG - Intergenic
912993627 1:114511907-114511929 ATACATAAGAATCAGCTGAAGGG - Intergenic
913397694 1:118390186-118390208 GTGGATGTGAATCATCATAAAGG - Intergenic
916428565 1:164705619-164705641 ATGCATGTGAAAAATCAAAAAGG - Intronic
916569164 1:166009703-166009725 ATGCATATAACACATCAAAATGG - Intergenic
916987346 1:170206117-170206139 AAGCAAATGAAGTATCAGAAAGG + Intergenic
918783843 1:188738013-188738035 ATGGAAGTGAATCATCATAAAGG + Intergenic
919282265 1:195506310-195506332 CTGCATATGAATCAAAATAAAGG + Intergenic
919356773 1:196534820-196534842 ATTCAGATGATTCAGCAGAAAGG - Intronic
919871078 1:201821993-201822015 ATGCATCTGAATCTTCATATCGG + Exonic
919994615 1:202737253-202737275 ATGTATAAGAATCATCTGGAAGG + Intronic
920213047 1:204342524-204342546 GTGCATATGAATCACCTGGAGGG + Intronic
921249112 1:213279942-213279964 AAGCATCAGAATCATCTGAAAGG - Intergenic
921609429 1:217193797-217193819 GGGCATATAAATCATAAGAAAGG + Intergenic
924904778 1:248440870-248440892 ATGCATATAAGACATAAGAATGG - Intergenic
924923109 1:248651180-248651202 ATGCATATAAGACATAAGAATGG + Intergenic
1062987374 10:1781435-1781457 CTGCATATGGAGCAGCAGAAGGG - Intergenic
1063586088 10:7353661-7353683 ATTCATTTCAATCATCACAAAGG + Intronic
1067356620 10:45534357-45534379 ATGCCTAAGAACCATGAGAAAGG + Intronic
1069252749 10:66291313-66291335 ATGCATCAGAATCACCAGAAAGG + Intronic
1071239214 10:83685504-83685526 AAGCAAATAAACCATCAGAAAGG + Intergenic
1071388191 10:85142647-85142669 ATGCATATGAATCCATGGAAAGG - Intergenic
1072828395 10:98631754-98631776 GTGCATATGAAACATATGAATGG + Intronic
1073334915 10:102699803-102699825 ATGCCCATGAATCTTCAGGATGG + Intronic
1077726835 11:4683194-4683216 ATGCATTTAATTCATGAGAAAGG + Intronic
1080454664 11:32407456-32407478 ATTCATATGAATATTCAAAAAGG + Intronic
1081209008 11:40308903-40308925 ATGCATATGAATCATCAGAATGG + Intronic
1082305137 11:50562932-50562954 AAACTGATGAATCATCAGAAAGG + Intergenic
1084554436 11:69867536-69867558 ATGCTGATGGAGCATCAGAATGG - Intergenic
1085950474 11:81325051-81325073 ATGGCTCTGAATCCTCAGAAAGG - Intergenic
1086376494 11:86206212-86206234 GTGCATATGTAACATCTGAATGG + Intergenic
1086957948 11:92953409-92953431 GTGGATATGGATCATCATAAAGG + Intergenic
1088159304 11:106850104-106850126 ATTTATATGAAACATCAGAATGG - Intronic
1088291815 11:108246964-108246986 GTGCTTATGAATCAACAAAATGG + Exonic
1089477494 11:118776942-118776964 AAGGATATGCATCATCAGAGGGG - Intronic
1089947373 11:122490869-122490891 GTGCATAAGAATCATCTGGAGGG + Intergenic
1090542602 11:127725289-127725311 ATGCACATAAAACAACAGAATGG - Intergenic
1090601861 11:128380426-128380448 ATATAAATGAATCATCATAAAGG + Intergenic
1091139006 11:133219523-133219545 ATGGATAAGAATCATCCGGAGGG + Intronic
1093458055 12:19383831-19383853 ATGCATCAGACTCACCAGAAGGG + Intergenic
1094007175 12:25767359-25767381 ATGTATATGAATGTTCATAAGGG - Intergenic
1094105479 12:26806885-26806907 ATGCATTTGAATCACCCTAAGGG + Intronic
1095601874 12:44022771-44022793 ATCTATGTGAATCATGAGAAAGG - Intronic
1095716956 12:45356610-45356632 ATGGAAATGGATCATCATAAAGG + Intronic
1096281057 12:50254127-50254149 ATGCATATGACTGAAGAGAATGG - Intronic
1096383388 12:51177906-51177928 ATGGAAATGGATCATCAAAAAGG - Intergenic
1096408029 12:51357885-51357907 ATGCATCAGAATCACCAGGAAGG - Intronic
1098617902 12:72553023-72553045 AAAAATATAAATCATCAGAAAGG - Intronic
1098622861 12:72625994-72626016 ATGCACCTGAAACATCAGATGGG + Intronic
1099093594 12:78343438-78343460 ATCCATAGGAAGCATCACAAAGG + Intergenic
1099271529 12:80516747-80516769 ATATAGATCAATCATCAGAATGG + Intronic
1100144157 12:91656774-91656796 GTGGAAATGAATCATCATAAAGG - Intergenic
1100393131 12:94161554-94161576 ATGCATTTGAATCATGGGAAAGG + Intronic
1101324671 12:103704820-103704842 GTTCATATGAATCAACAGACAGG + Intronic
1102629774 12:114267769-114267791 ATGCATTGGAATCACCAGAAGGG + Intergenic
1105897238 13:24726644-24726666 ATGCTTAGGAAACCTCAGAAGGG - Intergenic
1105916165 13:24918642-24918664 GTGGAAATGAATCATCATAAAGG + Intronic
1106030724 13:25999779-25999801 ATGCATATGGATTGGCAGAAAGG + Intronic
1106988727 13:35389173-35389195 ATGACTATGAATGATCAGAATGG - Intronic
1107176472 13:37405321-37405343 AAGCAAATGAATTATCAGAATGG - Intergenic
1107367855 13:39704486-39704508 ATGGAAGTGAATCATCATAAAGG + Intronic
1107372169 13:39764903-39764925 ATGCAGATTAAAAATCAGAAAGG - Intronic
1107791382 13:44005502-44005524 ATGCAGATGAATCAACAGCTTGG - Intergenic
1108932997 13:55853477-55853499 AGGGAGGTGAATCATCAGAATGG + Intergenic
1109779533 13:67090216-67090238 ATGTATATGAATCATCTGTGAGG + Intronic
1110492873 13:76129488-76129510 AAGCATTTGAGGCATCAGAAAGG - Intergenic
1110525857 13:76536199-76536221 ATGCATCAGAATCATCTGTAGGG + Intergenic
1111205545 13:85004659-85004681 ATGCAGATACATCATCAAAATGG + Intergenic
1111405763 13:87803020-87803042 ATGGAAGTGGATCATCAGAAAGG + Intergenic
1112521799 13:100102595-100102617 ATCCTTTTGAATGATCAGAAAGG + Intronic
1112671826 13:101649085-101649107 ATGCATATGAATCAAGAAATTGG + Intronic
1118426516 14:65669866-65669888 ATGCATGAGAATCATCTGGAAGG + Intronic
1118928560 14:70217329-70217351 CTGCATATAATTCATCAAAAAGG - Intergenic
1119490593 14:75029228-75029250 GTGGAAATGAATCATCATAAAGG + Intronic
1119625388 14:76170016-76170038 ATGCATCTGAAGCAGCAGGAGGG - Intronic
1119876033 14:78060210-78060232 ATGCATATGGCTCATCTGCAAGG + Intergenic
1120165336 14:81192912-81192934 ATGCTTAAGATTCACCAGAATGG + Intronic
1120701006 14:87698734-87698756 ATGCATTCTAATCACCAGAAAGG + Intergenic
1120882197 14:89422241-89422263 ATGCATAGGAATTACCTGAAGGG + Intronic
1125267331 15:37898153-37898175 AGGCAGATGAATCATGAGAAGGG - Intergenic
1125836569 15:42756919-42756941 ATATATATGAATCACCAGATGGG + Intronic
1126960164 15:53983890-53983912 CTGAATATGAACCATGAGAAAGG - Intergenic
1127908280 15:63393693-63393715 ATGCATTTGAATCCCCTGAAGGG + Intergenic
1130604345 15:85301699-85301721 ATATATATGAATCTTCAGATTGG - Intergenic
1131273187 15:90959258-90959280 AAGCATGTGAAACATCAGCATGG + Intronic
1131858917 15:96630413-96630435 TTGCTTATGAATCTTCAGAATGG - Intergenic
1133660468 16:7911484-7911506 GTGAATGTGGATCATCAGAAAGG + Intergenic
1138095529 16:54208379-54208401 CTGAACATGAATCATAAGAAGGG + Intergenic
1139200233 16:64968180-64968202 AAGAATATGAGACATCAGAAGGG - Intronic
1139393280 16:66619900-66619922 ATGCAGATGAATGACCAAAAAGG - Intronic
1142715873 17:1746726-1746748 TTGCATAAGAATCACCAGGAGGG - Intronic
1143303983 17:5931607-5931629 ATGCATATTAATCACTAAAAAGG - Intronic
1143682273 17:8485866-8485888 ATGCATATGAATGTTCATAGAGG + Intronic
1143940143 17:10532090-10532112 ATGCATAAGAATCACCTGAAGGG + Intronic
1144252462 17:13431503-13431525 ATGCATAAGAGTATTCAGAAAGG - Intergenic
1146526268 17:33569527-33569549 ATGGATGTTAAGCATCAGAACGG + Intronic
1147446466 17:40478022-40478044 ATGCATCTTGATCATCAGACTGG + Intronic
1149455477 17:56784570-56784592 ATGCATCAGAATCACCAGGAGGG + Intergenic
1149954487 17:61033221-61033243 ATGCATCAGAATCATCTGGAGGG + Intronic
1150709423 17:67517680-67517702 ATTGATATGAATGTTCAGAATGG + Intronic
1151636797 17:75354816-75354838 ATGAATATGAATTTTCAGATAGG + Intronic
1153288507 18:3478242-3478264 TGGCATAAGAATCATCAAAATGG + Intergenic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1153467997 18:5411106-5411128 ATGGATATAAATTATCATAATGG - Intronic
1153867597 18:9287185-9287207 ATGCATGTAAATCAGCAGGACGG - Intergenic
1155541172 18:26869919-26869941 AAGCATCTGAATTATTAGAAAGG - Intergenic
1156628854 18:38942898-38942920 ATTCATGAAAATCATCAGAAGGG - Intergenic
1157932599 18:51839860-51839882 AAGCATCAGAATCATCTGAAAGG - Intergenic
1158875138 18:61726418-61726440 GTGGAAATGAATCATCATAAAGG + Intergenic
1158926836 18:62273812-62273834 AAGCATATCTATCATCAGAATGG - Intronic
1162674220 19:12286307-12286329 ATGCATGAGAATCATCTGAAGGG + Intronic
1164334785 19:24304204-24304226 AAACTTATGAATCAACAGAAAGG - Intergenic
1164799705 19:31066616-31066638 GTGCACATGATTCATCAGGAAGG - Intergenic
1167113828 19:47477182-47477204 ATGCATCTGAATCCTCAGATGGG - Intronic
1167332321 19:48863907-48863929 GTGCATAAGAATCACCAGGAAGG + Intronic
1167411794 19:49348587-49348609 ATGTATCAGAATCATCTGAAGGG - Intronic
926499764 2:13639426-13639448 AAGCAAATGAATCATCCTAAAGG + Intergenic
927143007 2:20142430-20142452 ATGCATCAGAATCATCTGGAGGG - Intergenic
927339921 2:21971797-21971819 ATGCATATTTAGAATCAGAACGG + Intergenic
929267843 2:39939045-39939067 GTGCATAAGAATCATCTGGAGGG + Intergenic
930092986 2:47544799-47544821 ATGCATAGTATTCCTCAGAAAGG - Intronic
930864943 2:56113297-56113319 ATGCATCTGAATCACCTGGAGGG - Intergenic
932299093 2:70652587-70652609 ATGCATCTGAATACTCAGAGGGG + Intronic
932837607 2:75051773-75051795 ATGCATCAGAATCATCTGAAGGG - Intronic
933099435 2:78233454-78233476 GTGGAAGTGAATCATCAGAAAGG - Intergenic
933123312 2:78570906-78570928 ATGCATTTGAATAAACAGCAAGG - Intergenic
933853348 2:86389168-86389190 ATGTATATGATTCATATGAACGG - Intergenic
934913871 2:98282300-98282322 ATGCAAATGAATCATCATGTAGG + Intronic
935148772 2:100415209-100415231 ATATATTTGAATCATCAAAATGG - Intronic
939486337 2:142816249-142816271 ATGCATTAGAATCACCTGAAAGG - Intergenic
939850166 2:147294723-147294745 ATACATAGGGCTCATCAGAAGGG - Intergenic
940678864 2:156759047-156759069 ATACTTATGAATCCTCATAATGG + Intergenic
941196989 2:162465022-162465044 ATGGAGATAAAACATCAGAAAGG + Intronic
941331791 2:164186486-164186508 AAGCATATGTATGATCAAAAAGG - Intergenic
941552092 2:166929180-166929202 ATGCATTAGAATCATCTGGAGGG - Intronic
941608259 2:167627859-167627881 ATTCATATGAATACTCATAATGG - Intergenic
941711457 2:168718478-168718500 ATGCAGCAGAATCATCAGGAAGG - Intronic
942330370 2:174817387-174817409 ATGCACATAAAACATCTGAATGG + Intronic
942848379 2:180453835-180453857 GAGCATCAGAATCATCAGAAGGG - Intergenic
944437883 2:199710781-199710803 ATGAACTTGAATCATCAGTAAGG + Intergenic
945144064 2:206717474-206717496 ATGCATCAGAATCACCTGAAAGG - Intronic
1169016315 20:2295621-2295643 ATACATGTGTATCATGAGAAAGG + Intergenic
1169738542 20:8864826-8864848 ATGCCTATGATGCATCAGAATGG + Intronic
1170087809 20:12554903-12554925 ATGCATATAAAATATAAGAATGG + Intergenic
1170308646 20:14968600-14968622 ATGCATTAGAATCACCTGAAGGG + Intronic
1170713779 20:18814900-18814922 ATGCATCAGAATCACCGGAAAGG + Intronic
1171353818 20:24527871-24527893 ATGCATTTGAATCACCTGAAGGG - Intronic
1171933545 20:31250987-31251009 ATGGAAATGGATCATCATAAAGG - Intergenic
1172622574 20:36329361-36329383 AAGCAAATGAAACTTCAGAAAGG - Intronic
1173555917 20:43965567-43965589 ATGCAAATAGATCATCACAAAGG - Intronic
1175164769 20:57035683-57035705 ATGCAAATAAAGGATCAGAAAGG - Intergenic
1176716643 21:10355894-10355916 ATGCATCTGCACCATCAGCATGG - Intergenic
1177673594 21:24267313-24267335 ATGCATATGCATCACCAAAGTGG + Intergenic
1177711493 21:24781175-24781197 ATGCATTTAAATAATAAGAAGGG - Intergenic
1177828657 21:26112055-26112077 ATGCACATGAATGTCCAGAATGG - Exonic
1178733427 21:35127013-35127035 AAGCATAAGAATGAGCAGAATGG + Intronic
1178748309 21:35275021-35275043 TTGCATCTGGAACATCAGAAGGG + Intronic
1179199407 21:39202368-39202390 ATTCAGCAGAATCATCAGAAAGG - Exonic
1179377656 21:40865237-40865259 ATGCATATGAATAAAGACAAAGG - Intergenic
949121059 3:384696-384718 AGGCCTATTACTCATCAGAATGG - Intronic
951037260 3:17947472-17947494 ATTGATATCAATTATCAGAAAGG + Intronic
952488419 3:33840270-33840292 ATGGAAATGGATCATCATAAAGG + Intronic
952788888 3:37182539-37182561 ATACATATAAATAATCTGAATGG - Intronic
952840105 3:37639144-37639166 CTGCATCTGTCTCATCAGAAAGG + Intronic
953204885 3:40817311-40817333 ATGCATCAGAATCACCTGAAGGG - Intergenic
954300460 3:49698340-49698362 ATGCATATGGCTCTACAGAAGGG - Intronic
954951804 3:54481279-54481301 GTGCAAATGAAACATCAGAGGGG - Intronic
957475621 3:80719608-80719630 ATGCATGTGAATATTCAAAAGGG + Intergenic
957618094 3:82558485-82558507 ATACATATGGATCCTAAGAATGG + Intergenic
958013390 3:87910092-87910114 ATGTATATGAAGAATAAGAAGGG - Intergenic
958748659 3:98168002-98168024 ATGCATTTGAATCACCTGGAGGG + Intergenic
958752348 3:98206720-98206742 ATGCATTTGAATCAACTGGAGGG + Intergenic
959138845 3:102459243-102459265 ATGCATATAAATTAACAGACGGG - Intronic
959383627 3:105673994-105674016 ATGCATCAGAATCACCAGGAAGG + Intronic
959795308 3:110420621-110420643 GTGGAAATGAATCATCATAAAGG - Intergenic
959895119 3:111596569-111596591 AAGGAAATGAATCATAAGAATGG + Intronic
961960139 3:130845996-130846018 ATACATTTGAATCATCTGGAGGG - Intergenic
962053200 3:131841345-131841367 ATGCATAGAAATCATCACACAGG + Intronic
963506734 3:146195302-146195324 ATGCGTTTCAATCATCATAAAGG - Intronic
964345412 3:155749944-155749966 ATACATATGAATCAGTATAAAGG - Intergenic
965823946 3:172711724-172711746 ATCAATATAAATCATCATAATGG + Intergenic
966282612 3:178250443-178250465 ATGGAAATAAATCATCATAAAGG + Intergenic
966339433 3:178909043-178909065 ATGATTATTAATCATCAGAAAGG + Intergenic
967440585 3:189503214-189503236 ATGCATCAGAATCATCTGAAGGG - Intergenic
968122128 3:196133133-196133155 ATACATATGAATTATAAGGAAGG - Intergenic
972161199 4:36229993-36230015 ATGTATATAGTTCATCAGAAAGG + Intronic
973175778 4:47203330-47203352 ATGAATGTGAAACATCACAATGG - Intronic
976116870 4:81737220-81737242 ATGCAACTGAACAATCAGAACGG - Intronic
976576607 4:86679549-86679571 ATGCATCAGAATCACCTGAAGGG - Intronic
976916457 4:90381192-90381214 CTGCATATTAATTATCACAAGGG - Intronic
977117771 4:93053287-93053309 ATGCATCAGAATCATCTAAAGGG - Intronic
977302043 4:95279007-95279029 AGGCATAAGAATCAAGAGAATGG - Intronic
978127334 4:105150101-105150123 GTGCCTATGAATCATAAGAAGGG - Intronic
978311948 4:107394467-107394489 ATGCAAGTGGATCATCATAAAGG + Intergenic
978584869 4:110266715-110266737 ATCTATATGAATCTTGAGAAGGG + Intergenic
979125915 4:116971190-116971212 AACCATATCAATCATCATAAAGG + Intergenic
979430526 4:120624253-120624275 ATGCATATTAACCTGCAGAAGGG - Intergenic
979544745 4:121926944-121926966 ATGTATCAGAATCATCTGAAGGG - Intronic
980923032 4:139106028-139106050 ATACATAAGAATTATCAGAAGGG - Intronic
983112475 4:163769997-163770019 ATGGAAGTGAATCATCATAAAGG - Intronic
983979904 4:173982914-173982936 GTGAAAGTGAATCATCAGAAAGG + Intergenic
985381099 4:189395990-189396012 ATGAATATGACACATGAGAAAGG + Intergenic
986410954 5:7478754-7478776 ATGCATTAGAATCATCCAAAGGG + Intronic
987240491 5:15993502-15993524 AAGCTTATGAATCATGCGAAAGG + Intergenic
987734369 5:21820863-21820885 ATGCATATGAAACATCTTAATGG + Intronic
988296020 5:29363328-29363350 ATGGAAATGGATCATCATAAAGG + Intergenic
989548594 5:42704794-42704816 ATGCATATAATTTTTCAGAATGG + Intronic
989847908 5:46169270-46169292 AAACATATGAATCAAAAGAAAGG - Intergenic
991008588 5:61857390-61857412 GTGCATCAGAATCATCAGGAAGG - Intergenic
992182595 5:74212793-74212815 ATGCATTAGAATCATCTGAAGGG - Intergenic
992273316 5:75088457-75088479 AATCATAAGAATCATAAGAATGG - Intronic
992990861 5:82281740-82281762 ATGGAAATGGATCATCATAAAGG - Intronic
993475493 5:88359082-88359104 AAACATAGGATTCATCAGAAGGG + Intergenic
994635562 5:102341239-102341261 ATGAACATGAAGTATCAGAAAGG + Intergenic
994691894 5:103030027-103030049 ATGCAAATGATCCATCAGTAGGG + Intronic
994962149 5:106619286-106619308 ATGCATGAGAATCATCTGATGGG + Intergenic
995069172 5:107898430-107898452 GTGGAAATGAATCATCATAAAGG - Intronic
996475303 5:123912393-123912415 ATACAAATGACTCTTCAGAAGGG + Intergenic
996613894 5:125416199-125416221 ATCCAGTTGATTCATCAGAATGG - Intergenic
997278528 5:132620902-132620924 GTGGAAATGAATCATCATAAAGG + Intronic
999661557 5:153869114-153869136 ATGCAGATGAAGCAGCATAATGG - Intergenic
999882847 5:155886546-155886568 ATGCATGTGCAGCCTCAGAAAGG + Intronic
999884854 5:155910823-155910845 GTGCAAATGAATCATAAGATTGG - Intronic
1000221339 5:159217518-159217540 ATGCATAGGAGTCAGCTGAACGG + Intergenic
1000479149 5:161750032-161750054 ATTAAAATAAATCATCAGAATGG - Intergenic
1001370768 5:171198543-171198565 AGGCATCTGAATCATCTGGAGGG + Intronic
1001498494 5:172208583-172208605 ATGCATCAGAATCACCTGAAAGG - Intergenic
1001584142 5:172821425-172821447 ATGCATATGTATCCTCCCAATGG + Intergenic
1001750992 5:174131309-174131331 ATTCATAAGAATCAGCAGGAAGG + Intronic
1002873376 6:1188118-1188140 ATTCAGATGAAACATCAAAAGGG + Intergenic
1003243849 6:4367897-4367919 ATGCATCAGAATCATCTGGAAGG + Intergenic
1006887435 6:37394426-37394448 AAGCATATGAATCCTAGGAAAGG + Exonic
1007699691 6:43759351-43759373 ATGCATATGTATTATGAGGAAGG - Intergenic
1007946345 6:45830373-45830395 ACACATATGAATCATCACTAAGG - Intergenic
1008731006 6:54482587-54482609 ATGCACTAGAATCACCAGAAGGG - Intergenic
1009618653 6:66043699-66043721 ATATTTATGAATCATTAGAATGG - Intergenic
1009754905 6:67924714-67924736 ATGTATCAGAATCATGAGAATGG + Intergenic
1010728164 6:79359183-79359205 GTGGATATGGATCATCATAAAGG + Intergenic
1011016929 6:82767257-82767279 AAGCATCTGAATCACCTGAAGGG - Intergenic
1012323471 6:97882735-97882757 ATGCATCGGAATCACCAGGAAGG - Intergenic
1013036970 6:106394295-106394317 TTGTATATGTATCATAAGAAAGG - Intergenic
1013182330 6:107728696-107728718 ATCCAAATGAATTATCAGAAGGG + Intronic
1013570159 6:111415148-111415170 ATGCATAAGAATCATCAGAAAGG + Intronic
1014041744 6:116835169-116835191 GTGGAAATGAATCATCATAAAGG - Intergenic
1014594194 6:123312389-123312411 ATACTTATGTATCATCATAAAGG - Intronic
1015419799 6:132993996-132994018 ATGCCTATTAATCCTGAGAATGG - Intergenic
1017379039 6:153806000-153806022 ATACATCAGAATCATCTGAAGGG - Intergenic
1018826840 6:167414775-167414797 ATGAATTTCAATCATCACAAAGG - Intergenic
1021216538 7:17922605-17922627 ATGCCAATTAATGATCAGAAAGG - Intronic
1021461706 7:20894837-20894859 ATGCATTTGCATGAACAGAATGG - Intergenic
1021805539 7:24350937-24350959 CTGCAAATGAAGCATCAGAAGGG + Intergenic
1023293337 7:38689819-38689841 ATGCATCTGAATCACCTGGAGGG - Intergenic
1023539298 7:41248482-41248504 TTGCATAAGAATCATCATAGTGG - Intergenic
1025517758 7:61674682-61674704 AAGCATATCAATCAAAAGAAAGG + Intergenic
1025542082 7:62103330-62103352 AAGCATATCAATCAAAAGAAAGG + Intergenic
1027479158 7:78672794-78672816 ATGCATCAGAATCACCTGAAGGG - Intronic
1027550569 7:79588489-79588511 ATGGAAGTGGATCATCAGAAAGG - Intergenic
1027578984 7:79969026-79969048 AGGCAATTGAATCATCAGGATGG + Intergenic
1027848431 7:83416593-83416615 ATTCATAAGAATCATAAAAAGGG - Intronic
1028342305 7:89736394-89736416 CTGCATCTGAATCACCTGAAGGG + Intergenic
1028512439 7:91640356-91640378 ATGCTTCAGAATCATCAGGAGGG + Intergenic
1028715998 7:93969495-93969517 GTGGATATGAATAATCAGGAAGG + Intronic
1031218079 7:118923534-118923556 AATCATCTGAATCATCAGAATGG - Intergenic
1031337950 7:120560592-120560614 ATGCAAATGAATGCTAAGAAAGG + Intronic
1032443229 7:131958455-131958477 ATGCCTAAGAATCTCCAGAAAGG - Intergenic
1033166877 7:139047002-139047024 ACACATTGGAATCATCAGAAGGG + Exonic
1034873446 7:154704058-154704080 ATGCATATGAATGTTCTTAATGG - Intronic
1036438546 8:8758960-8758982 ATGCATCAGAATCATCTGGAGGG - Intergenic
1036764583 8:11540664-11540686 AACCATATAAATCATCAAAATGG + Intronic
1036989907 8:13580642-13580664 ATGCATATGGAAGACCAGAAAGG + Intergenic
1037439333 8:18898755-18898777 GTGGAAATGAATCATCATAAAGG + Intronic
1038924732 8:32126016-32126038 ATGCATGTGAAGAATTAGAAAGG - Intronic
1039303230 8:36232906-36232928 ATGCAAGTGAATTTTCAGAAGGG - Intergenic
1039992196 8:42497894-42497916 AAGCACATGAATCAGAAGAAGGG - Intronic
1041129073 8:54677289-54677311 ATGCATCTGCATCACCAGGAGGG - Intergenic
1041429933 8:57768232-57768254 TATCATCTGAATCATCAGAATGG - Intergenic
1041705158 8:60838844-60838866 ATGCAGGTGAAACCTCAGAAGGG - Intronic
1041861096 8:62513454-62513476 ATGAATTTGAATGATAAGAAAGG + Intronic
1042240370 8:66657998-66658020 CTACATATAAATCAACAGAAGGG + Intronic
1044395551 8:91706722-91706744 ATGTATATGTAGCATCAAAATGG + Intergenic
1045529892 8:102974419-102974441 ATGCATAAGAATGATAATAATGG - Intronic
1045866884 8:106877207-106877229 ATCCAGATGTATCATCAGACAGG + Intergenic
1047635587 8:126758587-126758609 ATTTATATAAATTATCAGAATGG + Intergenic
1048651562 8:136484205-136484227 GTGGAAATGAATCATCATAAAGG + Intergenic
1050637997 9:7633007-7633029 ATGAATATCAAACATCAAAAAGG - Intergenic
1050810681 9:9742957-9742979 ATGCCTATTAATTATTAGAAAGG - Intronic
1052086535 9:24273611-24273633 AAGCATAAGAATCACCAGATGGG + Intergenic
1052552109 9:29965184-29965206 ATGCACATGGATCATGAAAAAGG + Intergenic
1052619375 9:30885971-30885993 GTGAAAATGAATCATCATAAAGG + Intergenic
1054970397 9:71079626-71079648 ATGCATATGAGTCTTCCCAATGG + Intronic
1056431074 9:86528564-86528586 TTGCATATGATTTATGAGAATGG + Intergenic
1057880699 9:98790757-98790779 ATGCAGATGCATCATCATGAAGG + Intronic
1058073498 9:100626097-100626119 ATGCAAATAAAACATCAGTAAGG - Intergenic
1058923786 9:109641883-109641905 ATGCAATTTAATCCTCAGAAAGG + Intronic
1059571138 9:115437370-115437392 TTGTATTTGAATCATTAGAAGGG + Intergenic
1185539887 X:894751-894773 ATGCATAGGATGGATCAGAAGGG + Intergenic
1185754291 X:2641109-2641131 ATGCACCTGAATCATGGGAAAGG - Intergenic
1186358561 X:8813655-8813677 ATGCATAGGAACAAACAGAATGG + Intergenic
1186387876 X:9128222-9128244 GTGCATCTGAATCAGCAGAAAGG + Intronic
1186855332 X:13620966-13620988 ATGCATCTGAATCTTCTGATTGG - Intronic
1186902431 X:14071298-14071320 ATACACATGAATCCTCATAAAGG - Intergenic
1187014906 X:15316892-15316914 ATGCAAGTGAATGATCAGGAGGG - Intergenic
1188856774 X:35206417-35206439 GTGAAAATGAATCATCATAAAGG - Intergenic
1189922832 X:45920178-45920200 ATGCATATGATTTATGACAAGGG - Intergenic
1190692962 X:52927258-52927280 ATGCAAATGTATAATCAGAAAGG + Intronic
1192232615 X:69276459-69276481 ATGCATCAGAATCATCAAGAAGG + Intergenic
1192656235 X:72998113-72998135 TTGCATAATAATCCTCAGAATGG + Intergenic
1192665885 X:73084888-73084910 TTGCATAATAATCCTCAGAATGG - Intergenic
1193150974 X:78124375-78124397 ATGCATGAGAATCACCAGGAGGG - Intronic
1193570452 X:83135350-83135372 GTGGAAATGAATCATCACAAAGG + Intergenic
1194673232 X:96761655-96761677 ATGCAAATGAATCATTAAATGGG + Intronic
1195400624 X:104457752-104457774 ATGCATCAGAATCACCAGGATGG + Intergenic
1198070732 X:133146010-133146032 ATGGAAATGGATCATCATAAAGG + Intergenic
1199102150 X:143815085-143815107 ATGCTGATGAACTATCAGAAGGG - Intergenic
1200275181 X:154725293-154725315 ATGCATCTGAATCACCTGGAAGG + Intronic
1200972580 Y:9170066-9170088 ATGTATATGATTTATCCGAAAGG - Intergenic
1201641163 Y:16178451-16178473 AAGGAGATGAATCATCAGATGGG + Intergenic
1201661652 Y:16406875-16406897 AAGGAGATGAATCATCAGATGGG - Intergenic