ID: 1081211039

View in Genome Browser
Species Human (GRCh38)
Location 11:40334124-40334146
Sequence GTGTTTTAGTATGTATACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 180}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081211034_1081211039 24 Left 1081211034 11:40334077-40334099 CCTTGGTGCTCAAGATGGGAAAA 0: 1
1: 1
2: 0
3: 12
4: 220
Right 1081211039 11:40334124-40334146 GTGTTTTAGTATGTATACAGAGG 0: 1
1: 0
2: 1
3: 18
4: 180
1081211036_1081211039 1 Left 1081211036 11:40334100-40334122 CCTAACCTGGTGTTTTTCCTTGC 0: 1
1: 0
2: 2
3: 21
4: 242
Right 1081211039 11:40334124-40334146 GTGTTTTAGTATGTATACAGAGG 0: 1
1: 0
2: 1
3: 18
4: 180
1081211037_1081211039 -4 Left 1081211037 11:40334105-40334127 CCTGGTGTTTTTCCTTGCTGTGT 0: 1
1: 1
2: 3
3: 24
4: 376
Right 1081211039 11:40334124-40334146 GTGTTTTAGTATGTATACAGAGG 0: 1
1: 0
2: 1
3: 18
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081211039 Original CRISPR GTGTTTTAGTATGTATACAG AGG Intronic
903401923 1:23059893-23059915 GTGATTTCCTATGTATACGGTGG + Intronic
905946986 1:41911039-41911061 CTTTTTTAGTATCTTTACAGTGG - Intronic
908078627 1:60548989-60549011 GAGTTTGAGGATGTATACAAAGG - Intergenic
911283324 1:95958586-95958608 GTGAATTAGAATGTATCCAGGGG + Intergenic
917195828 1:172464881-172464903 GTGTTTAAAAATGTATAAAGAGG + Intronic
917571830 1:176274215-176274237 TTGCTTTAGTATATATACAGAGG - Intergenic
917761554 1:178164853-178164875 GTGTGTGTGTGTGTATACAGTGG + Intronic
918875808 1:190041715-190041737 ATGTGTTATTATGTATACACAGG + Intergenic
920633344 1:207674862-207674884 GTGTTTTTTTTTTTATACAGTGG + Intronic
920726212 1:208437572-208437594 GTGTCTTACTATGCAGACAGAGG - Intergenic
923805545 1:237253194-237253216 GTGAAATAGTAAGTATACAGTGG + Intronic
1065193018 10:23232501-23232523 GTGTGTTTTTATGTATACCGTGG - Intronic
1068293975 10:55043387-55043409 CTGTTTTTTTATGTAGACAGAGG - Intronic
1069523601 10:69147110-69147132 GTATTTTAGTGGGTATAAAGTGG + Intronic
1070799821 10:79238775-79238797 CTGTTTTAGTTTCTGTACAGTGG + Intronic
1073629392 10:105133253-105133275 GTGTTTTAGTCAGTATCCAATGG + Intronic
1074245959 10:111693665-111693687 ATTTATTAATATGTATACAGGGG + Intergenic
1077668950 11:4139768-4139790 TTGTTTGGGTATGTATACAGGGG + Intergenic
1079044591 11:17089907-17089929 TTGTTGTAGCTTGTATACAGTGG - Exonic
1081211039 11:40334124-40334146 GTGTTTTAGTATGTATACAGAGG + Intronic
1084619035 11:70256024-70256046 TTTTTTTAGTATGTATAGAGAGG - Intergenic
1084722955 11:70920067-70920089 GTGTTTTCATGTGTAAACAGAGG + Intronic
1085500131 11:77013528-77013550 CTGTTTTAGTAGGTATGTAGTGG - Intronic
1085930712 11:81079908-81079930 ATGTTTTATTTTGTATTCAGGGG + Intergenic
1086209376 11:84300129-84300151 CTATTTTAGTATGTTTACATAGG - Intronic
1086966837 11:93036753-93036775 ATGATTTAGGTTGTATACAGTGG - Intergenic
1087366247 11:97223213-97223235 GTGTATTGGTATGTATTGAGAGG + Intergenic
1088044137 11:105427031-105427053 TTGTTTGAGTATATATCCAGTGG - Intergenic
1088212077 11:107467608-107467630 GTGGTTAAGTATGTATACAGGGG - Intergenic
1090008011 11:123019509-123019531 GTGGTTTAGGAGGTAAACAGAGG - Intergenic
1090715794 11:129429722-129429744 GGGTTATATTATGTATACATGGG - Intronic
1092962978 12:13613841-13613863 GTGTTTACGTCTGTATTCAGAGG - Intronic
1093956676 12:25228444-25228466 GTGTTGTAGCATGTATATACAGG - Intronic
1096728502 12:53585396-53585418 GTGGTTCAGTATGTTGACAGTGG + Intronic
1098485385 12:71015359-71015381 TTGTTTTTGTGTGTATTCAGTGG + Intergenic
1098712381 12:73779404-73779426 CTTTTTTATTATGTATAGAGAGG + Intergenic
1098849067 12:75572993-75573015 GTGTATGTGTATGTATATAGAGG + Intergenic
1100425593 12:94482609-94482631 CTGATTTAGTAGGTCTACAGTGG + Intergenic
1100515673 12:95325316-95325338 GTGTGTGTGTATGTAGACAGTGG - Intergenic
1100785937 12:98078352-98078374 GTTTTTAAGTATATATACATTGG + Intergenic
1104375997 12:128266393-128266415 GTGTTTTATTATCTTTTCAGTGG - Intergenic
1106158408 13:27178715-27178737 GTGTTTGTGTGTGTGTACAGGGG - Intergenic
1112112367 13:96316291-96316313 GTGTGTGTGTATGTGTACAGTGG + Intronic
1113202206 13:107878579-107878601 GTGTTCTAGTTTGTGTGCAGAGG - Intergenic
1113338956 13:109403509-109403531 GTGTTTTTCTATTTATACATTGG - Intergenic
1113612115 13:111654459-111654481 GTGTTTCAGCATTAATACAGGGG - Intronic
1114837999 14:26226776-26226798 CTGCTTTATTCTGTATACAGGGG - Intergenic
1114915793 14:27263676-27263698 ATTTTTTAGGATGTCTACAGTGG - Intergenic
1116749061 14:48859213-48859235 TTCTTTTAGGATGTTTACAGAGG - Intergenic
1120247204 14:82021572-82021594 GTGTTTTAGTCTTTATGTAGAGG + Intergenic
1120491308 14:85181875-85181897 ATGTTTTAATATTTATGCAGGGG + Intergenic
1120781691 14:88491236-88491258 ATATTTTAGTATTTATACAATGG - Intronic
1120797605 14:88652184-88652206 GTTTTTCATTATGTATAAAGAGG - Intronic
1122449027 14:101788739-101788761 TTATTTTAGTATATATACAGAGG - Intronic
1125209166 15:37192131-37192153 GTGTGTGTGTGTGTATACAGTGG - Intergenic
1126983967 15:54281263-54281285 GTTTATTAGTCTTTATACAGAGG + Intronic
1127238877 15:57088562-57088584 GTGTTTTAATATGGTTTCAGTGG + Intronic
1127818460 15:62633600-62633622 GTGTGTGAATATGTAAACAGAGG - Intronic
1128591653 15:68903286-68903308 GTGTTTTAGAAAATATACAAAGG - Intronic
1128971727 15:72113723-72113745 GTGTGTTTGTATGTATATATGGG - Intronic
1129570228 15:76674838-76674860 GTGTATTTATATGTATACATTGG + Intronic
1129622286 15:77159213-77159235 TTGTTTTAGTAGGTACACTGAGG + Intronic
1133105335 16:3504304-3504326 GTGTTTTAAAATGTTAACAGTGG - Intronic
1135468728 16:22710285-22710307 CTGTTTCAGTGTGGATACAGTGG - Intergenic
1135714654 16:24752118-24752140 GTATTTTAGTATGTTTACCTTGG + Intronic
1141109520 16:81260807-81260829 ATGATTTAAAATGTATACAGTGG - Intronic
1142416468 16:89946013-89946035 GTGTTGTTGAATGTCTACAGAGG + Intergenic
1150517798 17:65832576-65832598 GTGTTCTAGTTTGTATGCATAGG - Intronic
1153960060 18:10132823-10132845 GTGTGTTGGTCTGCATACAGTGG + Intergenic
1155407086 18:25500944-25500966 GTTTTTTAGTATGTTCACAGAGG - Intergenic
1156332451 18:36136130-36136152 GTGTGTGTGTATGTATATAGAGG + Intronic
1156736616 18:40267309-40267331 GGGTTTTAGTATATTTACAGAGG - Intergenic
1158115626 18:53992120-53992142 GTTTTGTAATATGTATACACTGG - Intergenic
1159299254 18:66541951-66541973 GTGCTTTAAAATGTATGCAGTGG + Intronic
1159667635 18:71181948-71181970 CAGTTGTACTATGTATACAGAGG - Intergenic
1160390213 18:78524550-78524572 GTGTTTCTGTATGTACACATAGG - Intergenic
1162939555 19:14000445-14000467 GTGTGTTTGTATGCATGCAGTGG - Intronic
1164286027 19:23818636-23818658 GTGATTTAGCATGTAAATAGGGG + Intronic
1166021132 19:40030655-40030677 GTGTTTTATTATGTTTGCAAAGG + Exonic
1166024653 19:40070724-40070746 GTGTTTTATTATGTTTGCAAAGG + Intronic
925699477 2:6619914-6619936 ATGTATAAGTATGTATATAGAGG + Intergenic
926577955 2:14603067-14603089 GTATTTTAGTATCTAGACATCGG - Intergenic
927570801 2:24157924-24157946 GTGTTTTAGAATGTAGGCTGTGG - Intronic
928197721 2:29227382-29227404 GTGCTTTAATATGAATGCAGAGG - Intronic
930806010 2:55491530-55491552 GTGTTTAAGGCTGTAAACAGAGG + Intergenic
931804517 2:65790937-65790959 GTGTTTTGGAATGTACAAAGCGG - Intergenic
933530845 2:83509649-83509671 GTATGTTAGTATGTATAAATAGG - Intergenic
935865168 2:107380199-107380221 GTGTTTTAGAATGTTCACTGAGG + Intergenic
936056556 2:109266334-109266356 GTGTGTATGTATGTATACACAGG + Intronic
936601382 2:113899028-113899050 GGGTTTAAGTATGTATAAAATGG - Intronic
939373517 2:141333896-141333918 GTGTGTGAATATGTATGCAGGGG + Intronic
940613017 2:156013848-156013870 ATATTATAGTGTGTATACAGAGG - Intergenic
943896148 2:193363084-193363106 GTGGTATAGTAGGTATACTGTGG - Intergenic
944733996 2:202544314-202544336 GTGTATTAGTATGTGTATGGTGG + Intronic
945647988 2:212524569-212524591 GTAATTTAGTATGTGGACAGGGG - Intronic
945829091 2:214761105-214761127 GTATTTTATTATGAATACACTGG + Intronic
1169234425 20:3918816-3918838 GTGGTATATTATGTACACAGAGG + Intronic
1169444401 20:5659323-5659345 GTCCTTTAGAATGTATGCAGTGG - Intergenic
1171192372 20:23167834-23167856 TTATTTTAGTATATATAAAGTGG - Intergenic
1176913080 21:14591759-14591781 GGGTTTTAGTGTTTTTACAGTGG - Intergenic
1177470013 21:21548443-21548465 GTGGTTTGTTATGTAGACAGTGG - Intergenic
1177961847 21:27676902-27676924 GTGTTCTAATATGCATACACAGG + Intergenic
1178423306 21:32459169-32459191 GTGTTTGAGTGTGTATAATGGGG - Intronic
1181908008 22:26214955-26214977 GTGATTTAGTACGTATTCATTGG + Intronic
1182048391 22:27294818-27294840 GTGAGTTTGAATGTATACAGAGG + Intergenic
1182949638 22:34361007-34361029 GTTTGTTAGTAGGTATACATGGG - Intergenic
950980934 3:17303722-17303744 GTGGTTTAAGATGTATAAAGAGG - Intronic
952612139 3:35224744-35224766 TTGTTTTCATATGTGTACAGTGG + Intergenic
955307952 3:57853238-57853260 GTGTTTTAATATGGATTCTGAGG + Intronic
955666497 3:61354837-61354859 TTGTCTTAGTATGTGTACTGTGG + Intergenic
956505597 3:69935542-69935564 CTGATTTAATATGTACACAGAGG - Intronic
956629518 3:71301963-71301985 TTGTTTTAGTATTTATAAATTGG - Intronic
958428006 3:94001804-94001826 GTCTTTCAGTATGAATAGAGAGG - Intronic
960283962 3:115806985-115807007 GAGTTTTACTTTGTATACAAAGG + Exonic
963124591 3:141803436-141803458 GGTTTTTAGTATATTTACAGAGG + Intronic
963985558 3:151589900-151589922 GTTTTTTAGAATGTCTTCAGTGG + Intergenic
966043321 3:175518889-175518911 TTGTTTTAATATGTATACATAGG + Intronic
966756709 3:183378206-183378228 GTGGTTTAGAATGTACACAGTGG - Intronic
970300188 4:14673056-14673078 GTGTTTTAGGAAGGATACATGGG - Intergenic
970766068 4:19550442-19550464 GTGTTCTAGTATTTTTTCAGAGG + Intergenic
971630833 4:28991445-28991467 CTGTTTTAGTTTTTATTCAGTGG + Intergenic
973285152 4:48407747-48407769 GTTTTTTAGTATATTCACAGAGG + Intronic
976576906 4:86683169-86683191 GTGTATTTGTATGTATAGAGAGG + Intronic
977429190 4:96909887-96909909 TAGTTTTACTATGGATACAGGGG - Intergenic
977799328 4:101207191-101207213 GTGTTTTAGGATGTTAGCAGTGG - Intronic
979134625 4:117094644-117094666 GGATTTTAGTATGATTACAGAGG + Intergenic
979735805 4:124082108-124082130 GTGTTTTAGTGTGAATAAATGGG - Intergenic
982186689 4:152809071-152809093 GTGTTGTAGCATGTAAACACAGG + Intronic
985383849 4:189424647-189424669 GTGTGTGTGTATGCATACAGGGG - Intergenic
986561975 5:9069450-9069472 CTGTATTAGTATGTTTCCAGTGG + Intronic
987671408 5:21014749-21014771 GAGTTTTAGTAATTATAGAGAGG - Intergenic
988300090 5:29412630-29412652 CTTTTTTAGTATATTTACAGTGG - Intergenic
989992914 5:50789433-50789455 GTGTTTTGGTATGCATCCAGAGG + Intronic
990077648 5:51871027-51871049 GTGTGTGTGTGTGTATACAGGGG + Intergenic
990303731 5:54474724-54474746 GGGTTTTAGTGTATCTACAGAGG + Intergenic
990713534 5:58610438-58610460 CTGTTATAATAGGTATACAGTGG + Intronic
994527789 5:100928304-100928326 GTGATTTGGTCTGTATCCAGAGG - Intergenic
995390012 5:111629777-111629799 CTATTCTAGTAAGTATACAGAGG - Intergenic
995631530 5:114138708-114138730 GTGCTTTACTACCTATACAGTGG - Intergenic
996435281 5:123427441-123427463 GTGTATTTGTGTGTATACAGTGG - Intergenic
996857158 5:128021207-128021229 GAATTTTAGTATATTTACAGAGG - Intergenic
996919529 5:128751530-128751552 ATGTTTTAGTCTTCATACAGTGG + Intronic
1000917093 5:167095520-167095542 TTGTTTTATTATGTATACCACGG + Intergenic
1001356520 5:171030465-171030487 GTGTTTTAAAATGTCTCCAGTGG + Intronic
1003688655 6:8329766-8329788 GTGTTCTAGCATGCATGCAGGGG - Intergenic
1003731852 6:8833259-8833281 GCCTTTTACTAGGTATACAGTGG + Intergenic
1003841254 6:10122580-10122602 GTGTTATCCTATGTACACAGAGG + Intronic
1003870051 6:10394935-10394957 GTGTTTTAGAAAGTATACATTGG + Intronic
1010062656 6:71642495-71642517 GTCTTTTGGTATGTATTCTGAGG + Intergenic
1010916410 6:81624240-81624262 GTGTTTCAGTATGGACACAGGGG + Intronic
1012646927 6:101696507-101696529 GGATGTTAGGATGTATACAGTGG + Intronic
1013895377 6:115081700-115081722 GTGTGTTTGTATGTATGTAGGGG + Intergenic
1014037559 6:116784973-116784995 GTGTTTTATTAGAGATACAGAGG + Intergenic
1015490734 6:133822908-133822930 GTGTTTGGGTGTGTATTCAGGGG - Intergenic
1015994444 6:138983995-138984017 GTGTTTTGGTGAGAATACAGTGG - Intronic
1016656553 6:146524886-146524908 GCTTTTTTGTATGTAAACAGGGG + Intergenic
1017714922 6:157202641-157202663 GTGTGTGTGTGTGTATACAGTGG - Intronic
1021449849 7:20774443-20774465 GTGTTTTAGTATGTATATCCAGG - Intronic
1026224365 7:68427640-68427662 GTGTTTGAGGATTAATACAGAGG + Intergenic
1027745362 7:82066800-82066822 ATGTTTTAGTAGGTGTCCAGAGG + Intronic
1028367993 7:90057079-90057101 TTATTTTAGTTTTTATACAGTGG - Intergenic
1030253322 7:107475969-107475991 CTATTTTGGTGTGTATACAGAGG - Intronic
1030358890 7:108574329-108574351 TTGTTTTAATATGTATCCATAGG - Exonic
1030615460 7:111733792-111733814 GTATATCAGTATGTGTACAGAGG - Intronic
1031848341 7:126832473-126832495 GTGTTTTATTATGTATATTGGGG - Intronic
1036670467 8:10781971-10781993 GTGTGTATGTATGTATACAGTGG + Intronic
1037082320 8:14802719-14802741 GTGTTTTAGCATGTGTATTGTGG + Intronic
1037449189 8:18999724-18999746 GTGGTGTAGTTAGTATACAGAGG - Intronic
1037706624 8:21321018-21321040 TGGTTTTAGGATGTTTACAGGGG - Intergenic
1038606393 8:29009955-29009977 GTGTTTTAGTCTGTGTGCAAAGG - Intronic
1038709863 8:29933413-29933435 TTGCTTTTGGATGTATACAGAGG + Intergenic
1038774924 8:30520404-30520426 GTTTTTTAGTATATTTTCAGGGG + Intronic
1039983372 8:42427976-42427998 GTGAGTTTGTCTGTATACAGAGG + Intronic
1040049157 8:42994856-42994878 GTGTTTTATGATGTTTACAATGG + Intronic
1040700596 8:50059393-50059415 GGCTTTTAGTATATCTACAGAGG + Intronic
1042270162 8:66946612-66946634 AGGTTTTGGTATGTTTACAGAGG - Exonic
1043323494 8:79020652-79020674 ATCTTTTAATAGGTATACAGTGG - Intergenic
1044259388 8:90099648-90099670 ATGTTTTGATATGTATACACAGG + Intergenic
1044982450 8:97730521-97730543 TTGTTTTAATAAGTACACAGGGG + Intergenic
1046427500 8:114074194-114074216 GTGGTTTATTATTTATACATAGG + Intergenic
1049667864 8:143855654-143855676 GTGTTTTAGTCTCTACTCAGTGG - Intergenic
1050114384 9:2248557-2248579 GTCTTTTAGTATGTTTGGAGGGG + Intergenic
1051740978 9:20251922-20251944 GTGTTTCAGTAAGGATACAGAGG - Intergenic
1052621103 9:30911296-30911318 GTGTTTCAGTATTAATACAAAGG - Intergenic
1057534517 9:95886318-95886340 CTGTGTTAATATGTATACATAGG + Intronic
1058350755 9:104019368-104019390 GATTTTTAGTATGAATATAGGGG + Intergenic
1059620515 9:115999784-115999806 GTGTGTTAGTATGTACATAATGG - Intergenic
1059814450 9:117896205-117896227 GCTTTTCAGTATGTATCCAGAGG + Intergenic
1059858664 9:118431862-118431884 GTGTTTGAGAAAGTATGCAGTGG + Intergenic
1060047806 9:120354359-120354381 GTATTTTAGTATGTATCCACAGG - Intergenic
1060561939 9:124552726-124552748 GGGTTGTTGTATGTATTCAGTGG + Intronic
1186643325 X:11480547-11480569 GGCTTTTAGTATATTTACAGAGG - Intronic
1186831381 X:13393728-13393750 GTGTTTACATGTGTATACAGTGG - Intergenic
1190589215 X:51980752-51980774 TTGTTTGACTATGTATGCAGGGG + Intergenic
1194682261 X:96868966-96868988 TTGCTTTAGTATGCATATAGTGG + Intronic
1194960548 X:100230400-100230422 GGATTTTAGTGTGTATGCAGTGG - Intergenic
1197484394 X:127029825-127029847 GTGTTTTAATATATATGAAGAGG - Intergenic
1197872239 X:131071289-131071311 GTGCTCTAGAATGTATAAAGGGG + Intronic
1197889839 X:131258416-131258438 ATGTGTTACTATGCATACAGTGG + Intergenic
1199131399 X:144192248-144192270 GGCTTTTAGGATGTATACGGAGG - Intergenic