ID: 1081212826

View in Genome Browser
Species Human (GRCh38)
Location 11:40357175-40357197
Sequence ACCAAAGTCAGCCAAAGATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081212826 Original CRISPR ACCAAAGTCAGCCAAAGATA GGG Intronic
905288422 1:36903318-36903340 ACCAAAGTCTGGCAAGGATGCGG + Intronic
906536925 1:46556245-46556267 ACCAAGGTCAGCCAAAACCAAGG + Intergenic
908457047 1:64314034-64314056 TACCAAGTCAGCCAAAGACATGG + Intergenic
908597391 1:65703158-65703180 ACTATAGGCAGCCAAGGATACGG - Intergenic
912118588 1:106439493-106439515 GCCACAGTCTGCCAAAGATGGGG + Intergenic
913356893 1:117931693-117931715 GCCAAAGACAGACAAACATAAGG + Intronic
917594969 1:176519984-176520006 AACAAATTGAGCCAAAGATAAGG - Intronic
918758409 1:188368337-188368359 ACAAAAGTCCACCAAAGACAGGG + Intergenic
924200291 1:241651480-241651502 AATAAAGTGAGCCAAGGATAAGG - Intronic
924297104 1:242598804-242598826 ACCTAAGTGAGCCAAAAAGAGGG + Intergenic
1063215451 10:3921577-3921599 TCCTAAGGCAGCCAAAGAAATGG - Intergenic
1064056405 10:12101474-12101496 ATTAAAGTTAGTCAAAGATATGG + Intronic
1065527491 10:26637950-26637972 ACCAAAGCCAGCCCAAGGCAGGG + Intergenic
1065528530 10:26646152-26646174 ACCAAAGTCAGCCCCAGTCAGGG + Intergenic
1066297082 10:34063883-34063905 ACAATAGTCTTCCAAAGATATGG + Intergenic
1069020781 10:63486082-63486104 ATGAAAGTCAGCCAAAGACGTGG + Intergenic
1069288475 10:66746129-66746151 ACCGAAGACAGCCAGAGAGATGG - Intronic
1070129988 10:73649054-73649076 ACCAAGGACAGTTAAAGATAAGG + Intronic
1073671018 10:105588915-105588937 ACCAAACTTTGGCAAAGATACGG - Intergenic
1074880874 10:117657245-117657267 ACCACAGCCAGCCAAGGATCTGG - Intergenic
1077737172 11:4803742-4803764 ATCAAAGCCAGCCACAGAGAAGG + Exonic
1078149335 11:8745353-8745375 ACCAAAATCAGGTACAGATAGGG - Intronic
1079165390 11:18036646-18036668 TCCCAAGTCAGCCTAAGATGGGG + Intronic
1081212826 11:40357175-40357197 ACCAAAGTCAGCCAAAGATAGGG + Intronic
1081298674 11:41423826-41423848 GCCAATGTCAGCCACAGATAGGG + Intronic
1081378655 11:42388779-42388801 ACCAAAGTCAGGAAGAGACACGG + Intergenic
1081422385 11:42884960-42884982 ACCAAAACAAGCCAAAGATTGGG + Intergenic
1083738041 11:64692966-64692988 ATCAAAATCAGCCAGAGAGAAGG + Intronic
1085368068 11:75971484-75971506 ACCAAATGCTGGCAAAGATATGG - Intronic
1085432726 11:76468296-76468318 ACCATAGTAAGCCAAATCTAAGG - Intronic
1087639326 11:100739222-100739244 ACCAAAGTGATCAAAAAATAAGG + Intronic
1087743558 11:101916322-101916344 AACAGAGTCAGCCAAAGAGCAGG - Exonic
1090104565 11:123838574-123838596 ACCAAAGTCAGCAAGAGTGAAGG - Intergenic
1090138201 11:124222748-124222770 TCCAAAGTTTGCCAAGGATATGG - Intergenic
1090432356 11:126656684-126656706 ACCAAACTGTGCTAAAGATACGG - Intronic
1091096481 11:132827407-132827429 ACCAAATTCTGGCAAAGATATGG + Intronic
1095717652 12:45365230-45365252 CTCAAAGTCAGCCAGAGGTAAGG + Intronic
1097975251 12:65678898-65678920 AACAAAGACACACAAAGATAAGG + Intergenic
1098826387 12:75302870-75302892 ACCAAGCTCTGGCAAAGATATGG + Intronic
1099690442 12:85945089-85945111 ACCAGACTCAGCCAATGAAATGG - Intergenic
1099877873 12:88431625-88431647 ACCAAACACAGGCAGAGATATGG + Intergenic
1101812341 12:108118830-108118852 ACAACAGTGAGCTAAAGATATGG - Intergenic
1102576556 12:113859515-113859537 GCCAAAGTCAGGCAAAGCTCTGG + Intronic
1103298801 12:119910861-119910883 ACCAAAGTCAACGATAGGTAAGG + Intergenic
1105444437 13:20440527-20440549 AAAAAAGTCTGCCAACGATATGG + Intronic
1106804178 13:33289309-33289331 ACCAAAGACAGCAAAAGAGAAGG + Intronic
1107732701 13:43364808-43364830 ACCAAACTCAGCAAAAGAGTCGG + Intronic
1108075775 13:46678159-46678181 TTCAAATTCAGCCTAAGATAAGG - Intronic
1108791605 13:53975001-53975023 AACCAAATCAGACAAAGATAAGG + Intergenic
1110775050 13:79398358-79398380 AGCACTGTCAGCCAAAGATAAGG + Intronic
1111220569 13:85199888-85199910 ATAAAGGTCAGCCAAACATATGG - Intergenic
1111588737 13:90315519-90315541 ATCAAAATCAGCCAAAGACAAGG - Intergenic
1113002238 13:105654656-105654678 ACCAAAGATAACCAGAGATAAGG + Intergenic
1113149313 13:107243888-107243910 ACCCAATTTAGCCAAAGAAATGG + Intronic
1113612915 13:111660498-111660520 ACCACTGGCAGCCAAAGAAATGG - Intronic
1116678232 14:47933453-47933475 CCAAAAGTAAGCAAAAGATATGG + Intergenic
1116744674 14:48802243-48802265 ACCAAAGCCAGGCAAAGACACGG - Intergenic
1116834681 14:49758698-49758720 ATCAAAGCCAGGCAAAGACAGGG - Intergenic
1117226114 14:53661074-53661096 ACCAAATGCTGGCAAAGATATGG - Intergenic
1117801857 14:59452584-59452606 ACCAAATGCTGGCAAAGATATGG + Intronic
1120784512 14:88520124-88520146 ACCACACCCAGCCAAAGATAAGG - Intronic
1122028422 14:98894838-98894860 ACCAAAGTTGAGCAAAGATAAGG - Intergenic
1125048509 15:35271084-35271106 ACCACTGACAGCCAAACATAAGG + Intronic
1126076741 15:44918754-44918776 ATTAAAATCAGCCATAGATAAGG - Intergenic
1126490184 15:49228424-49228446 AACACAGTCAGACAAATATAAGG - Intronic
1127284201 15:57518292-57518314 ACCGAAGACACCCATAGATATGG - Intronic
1129049136 15:72763473-72763495 ACCATACCCAGCCAAAAATATGG + Intronic
1129286299 15:74527984-74528006 ACCAAAGAAAGCCAAAATTAAGG + Intergenic
1129530277 15:76259690-76259712 TCCAAAGTCAGCCACACACACGG + Intronic
1130792032 15:87165560-87165582 TTCAAAGTCAGGCAAAGGTAGGG - Intergenic
1135005594 16:18819182-18819204 ACTAAAGTGATCCAAAGATTTGG - Intronic
1135085454 16:19471378-19471400 ACCAAACCCAGCCAAATAAAGGG + Intronic
1135179146 16:20257769-20257791 CCCAAAGTCAGCCAGAGAGAGGG - Intergenic
1135622052 16:23964362-23964384 CGCAAAGGCAGCCATAGATAAGG - Intronic
1139509068 16:67416205-67416227 GCCAAAGTCAGCCAGAGGTTCGG + Exonic
1139914672 16:70420696-70420718 ACAAAAGAAAGCTAAAGATAGGG - Intronic
1140697907 16:77553166-77553188 ACCAAAGTCATCCCAAGTAAGGG + Intergenic
1140743575 16:77962385-77962407 ACCAAAGGGAGCCATAGGTAGGG + Intronic
1140990215 16:80203703-80203725 ACCAACATAAGCCAAAAATAAGG + Intergenic
1143642758 17:8208642-8208664 ACCTAAGTAGGCCTAAGATAAGG + Intronic
1149200453 17:54179669-54179691 GCCAAAGTCAGCCAACTATGAGG - Intergenic
1150242019 17:63642042-63642064 ACCATAATAAGCCATAGATAAGG - Intronic
1151044145 17:70899561-70899583 ACAAAATGCAGGCAAAGATATGG + Intergenic
1154220779 18:12451846-12451868 AGTAAAGTCAGTCAAAGCTATGG + Intronic
1157072725 18:44428191-44428213 ACCAAAAACTGACAAAGATAGGG - Intergenic
1158504773 18:58037224-58037246 ACAAAAAGCAGCTAAAGATAAGG + Intergenic
1159077435 18:63697368-63697390 ACCAAATGTAGACAAAGATATGG - Intronic
1159168418 18:64731511-64731533 ACCAAAGTGAGCTAAAAGTAAGG - Intergenic
925377018 2:3393984-3394006 AACAAAGAAAGCCAAAGGTATGG + Intronic
926454692 2:13051838-13051860 AACAAAGTCAATCAAAAATAGGG - Intergenic
926608054 2:14917404-14917426 ATCAAAGCCAGCCAGAGACAGGG + Intergenic
926689045 2:15720173-15720195 AACAAAGTCAGCCAACCAGAGGG - Intronic
927598563 2:24419929-24419951 ACCAAATGGAGGCAAAGATATGG + Intergenic
928008948 2:27589594-27589616 AGCAAAGTAAACCAAAGAAAAGG - Intronic
929893795 2:45940512-45940534 GCCCAAGTCAGTCAAAGAAATGG + Intronic
930464730 2:51733590-51733612 ACCAAAATCATCCAAGGAAAGGG - Intergenic
931370784 2:61660764-61660786 CCCAGAGTTAACCAAAGATATGG - Intergenic
931518194 2:63065747-63065769 ACTAAACTCTGGCAAAGATATGG - Intergenic
934533737 2:95114792-95114814 ATCTAAGTCAGCAAGAGATATGG + Intronic
935793534 2:106616519-106616541 ACCAAGTGCTGCCAAAGATATGG - Intergenic
936830199 2:116635069-116635091 ACCAAAGTTAGCCAATAAAATGG - Intergenic
936979800 2:118253920-118253942 ACCAAAGACAGCAAATGAGAAGG + Intergenic
938793788 2:134701575-134701597 ACCAAACTCAGCCAAAGATGGGG + Intronic
939411317 2:141828697-141828719 ACCCAAGGCAGCCAATGATGTGG + Intronic
939779286 2:146424465-146424487 ACCAAAGTAAGCAGAAGAAAGGG + Intergenic
942582518 2:177434123-177434145 ACCAAAAGCAGTCAAAAATAGGG - Intronic
942829039 2:180216785-180216807 ACCAAAATCTGGCAGAGATACGG + Intergenic
943194890 2:184733489-184733511 ACCAAAATCAGACAAAGATAAGG - Intronic
944725778 2:202469821-202469843 ACCAAAGTTATTGAAAGATAAGG + Intronic
945007742 2:205426946-205426968 AGTAAAATCAGCAAAAGATATGG + Intronic
948329269 2:237152026-237152048 ACCAAAGTGAGCAAATTATATGG + Intergenic
1169070059 20:2720435-2720457 ACCCAAGTCATCTAAAGAAAGGG - Intronic
1169884502 20:10383480-10383502 ACCAAACACAGGCAAAGATGTGG + Intergenic
1174261174 20:49296443-49296465 ACCCAAGTCAGCAAAGAATATGG - Intergenic
1177360247 21:20059574-20059596 ACCAAACTCAAACAAAGACATGG + Intergenic
1177673085 21:24258988-24259010 AAAAAAATCACCCAAAGATATGG - Intergenic
1178221300 21:30662952-30662974 ACAAAAGTCAGCCAAAGCTTAGG - Intergenic
1180194682 21:46185822-46185844 ACCAAAGTTATCAAAAGAGAAGG + Intergenic
1181897007 22:26119048-26119070 ACCAAATGCTGGCAAAGATATGG + Intergenic
949174141 3:1038333-1038355 AACAAATTCTGCCAAGGATATGG - Intergenic
949830022 3:8204385-8204407 ACCAAATAAAGCCAAAGAAATGG - Intergenic
950774380 3:15337045-15337067 ACCACACTCAGCCAAAGAGTTGG + Intronic
951022783 3:17798809-17798831 ACCACAGTCAGCAAATGAGAAGG - Intronic
952665269 3:35896371-35896393 ACCAATGTCAGCCAAAGTTTAGG + Intergenic
953099949 3:39814250-39814272 ACCAGTCACAGCCAAAGATATGG - Intronic
953508416 3:43509545-43509567 ACCAAATTCTGGCAAGGATATGG + Intronic
953968331 3:47327297-47327319 ATCAAAGACACCCAAAAATAAGG + Intronic
954519415 3:51211096-51211118 ATTAATGTCAGCCCAAGATATGG - Intronic
955958152 3:64311611-64311633 GCTAAAGCCAGCCAAAAATATGG + Intronic
956020426 3:64927887-64927909 ACCAAAGTCTGCCAAAGCTGAGG - Intergenic
957654002 3:83048120-83048142 ACCAAGTTTAGACAAAGATATGG + Intergenic
957847338 3:85755151-85755173 TCCATTGTCAGCCAAAGTTATGG + Intronic
957995588 3:87685491-87685513 ACCAAAGCCAGAAAAAGAAATGG + Intergenic
958704510 3:97637541-97637563 AGCAAAGTCTGCCAAAAAAAAGG - Intronic
958768013 3:98394460-98394482 ACACAAGTCAGCCAAAGAGAAGG + Intergenic
959475355 3:106804643-106804665 TCAAAAGTTGGCCAAAGATAGGG - Intergenic
960482101 3:118204394-118204416 ATGAAAGTAAGCCAAAAATAGGG - Intergenic
962156607 3:132954984-132955006 ACGAAAGTAACCCACAGATATGG - Intergenic
963218130 3:142774089-142774111 ACATATGTCAGCCAAAGATTTGG + Intronic
964142332 3:153418392-153418414 ACTAAAGCCAGCTAAAGAGAAGG - Intergenic
964176866 3:153834208-153834230 TACAAAGTCAGCCAATTATATGG - Intergenic
964999171 3:162930404-162930426 ATCAAAGGCAGCCAAATATCAGG + Intergenic
965868699 3:173239118-173239140 ACTAAATTAAGCCAAAGAGAAGG - Intergenic
966535685 3:181031189-181031211 ATAAAAGTCAGCCAGAGATTTGG + Intergenic
968122942 3:196139027-196139049 ATGAAAGTCAGCCAAGGAGATGG - Intergenic
969218281 4:5740937-5740959 ACCAAATTCTGGCAAAGATGTGG + Intronic
970613981 4:17750905-17750927 ACCAAAGCCAGTCACTGATAAGG - Intronic
970811464 4:20099400-20099422 TCAAAAGTCAGCCAAAGAACGGG - Intergenic
974807674 4:66900642-66900664 CCCAAACTCAGCTAAAGAAATGG - Intergenic
974845343 4:67345176-67345198 ACAAAAGCCAGCAAAAGATAAGG - Intergenic
975861879 4:78686143-78686165 CCCAAAGACAGCCACAGATATGG + Intergenic
975995225 4:80305984-80306006 ACCAGAGCCAGCCTAAGATCTGG + Intronic
977773216 4:100884001-100884023 AACAAATGCTGCCAAAGATATGG - Intergenic
979321623 4:119331551-119331573 AAAAAAGTCAGCAAAAGAAAAGG - Intergenic
980063190 4:128154210-128154232 AGCAAAGTACACCAAAGATAGGG - Intronic
980391572 4:132154616-132154638 CCCAAATCCAGCCAAAGAAAAGG - Intergenic
983074562 4:163309897-163309919 ACCTAAGTCAGCCAAATACAGGG - Intergenic
984594957 4:181656280-181656302 ACAGAAGCCAGCCAAAGAAAGGG + Intergenic
986035722 5:3935415-3935437 ACCAAATTCTGGCAAGGATATGG - Intergenic
987332130 5:16866753-16866775 ACCAAACTCAGGGACAGATAGGG - Intronic
988720578 5:33874428-33874450 ACCAAATGCTGGCAAAGATATGG + Intronic
991611620 5:68455476-68455498 TCCAAAGACAGCCAAAGAGAAGG + Intergenic
992222444 5:74586162-74586184 ACCAAATTAAGCCAAAGAAATGG + Intergenic
992424001 5:76636746-76636768 GCCAAAAGCAGCCAAAGAGAAGG - Intronic
998462798 5:142322060-142322082 ACGAAAGTCAGCCAAACCTCTGG + Intronic
999782430 5:154860226-154860248 TCCAAAATGAGCCTAAGATAGGG - Intronic
999939837 5:156530419-156530441 ACTGAAGTCAGCCATAAATACGG - Intronic
1000622067 5:163497158-163497180 TCCAAAGTCAGCAAAAGACTGGG + Intergenic
1001523292 5:172411010-172411032 ACAAAAGTCAGCCTGAGATGAGG + Intronic
1002307033 5:178289741-178289763 ACCAAGGTGAGCCCAAGATTTGG + Intronic
1003748456 6:9028698-9028720 CTCAAAGTCAGCCAGAGATAAGG - Intergenic
1003775659 6:9359968-9359990 ACCAAAGGCTGACAAGGATAGGG + Intergenic
1003966974 6:11261995-11262017 TCCAAAGTCAGATAAAGTTAAGG - Intronic
1004958780 6:20761274-20761296 ACCAAATTCTGGCAAGGATATGG + Intronic
1009211364 6:60867170-60867192 CCCGATGTCAGCAAAAGATATGG - Intergenic
1009959827 6:70505403-70505425 ATCAAGGTCACGCAAAGATAAGG - Intronic
1011336052 6:86260759-86260781 ACCAAAGTCAGATAAGGAAAAGG - Intergenic
1011963727 6:93125346-93125368 AGCCAAGTCAGCCACAAATAGGG + Intergenic
1014394408 6:120907680-120907702 ACTAAAGTAAGACAAAGAAAAGG + Intergenic
1016746273 6:147583547-147583569 ATCAGAGTCAGCTAAATATATGG - Intronic
1020219064 7:6220595-6220617 ACCAAAGGCTGGCAAAGATGTGG + Intronic
1022136102 7:27449831-27449853 AGCAAAATCAGACAAAGACATGG - Intergenic
1023381950 7:39617201-39617223 TCCAGAGTCAGCCAAGGAAATGG - Intergenic
1030630470 7:111889798-111889820 TACAAAGTCAGCCAAATAGAAGG - Intronic
1031223087 7:118997623-118997645 ACCAAAGTCAGCAAACACTATGG - Intergenic
1031946229 7:127843876-127843898 ACCAAAGGCAGGCAAGGATGTGG - Intronic
1032169927 7:129576158-129576180 AACCAAGTCAACCAAAGACATGG + Intergenic
1033314822 7:140288393-140288415 ACCAAAGTCAGCCAAGTCCAGGG + Intergenic
1038885718 8:31660564-31660586 ACAGAAGTTACCCAAAGATAGGG - Intronic
1039209418 8:35195593-35195615 ACCAAACTCAGGAAAAGAGAAGG + Intergenic
1041427336 8:57737614-57737636 AACTCAGTCAGACAAAGATAAGG - Intergenic
1043015237 8:74931461-74931483 ACCAAAGTCTGTCAAGGATGTGG - Intergenic
1044303371 8:90610304-90610326 ACCAAAGTCACTCAGAGAAAGGG + Intergenic
1047710382 8:127545901-127545923 TCCAAAGCCAGCCAAAGAGTTGG + Intergenic
1049866257 8:144939193-144939215 TCCAAAGCCAGATAAAGATATGG - Intronic
1056982036 9:91323086-91323108 ACCAAAGTCAAAGAAAGATAAGG + Intronic
1058200466 9:102032967-102032989 ACCATAGGCAGCCATAGGTAGGG - Intergenic
1060255476 9:122025648-122025670 ACCAAATTCTGGCAAAGATATGG + Intronic
1060396234 9:123318898-123318920 AGCAAAGTCAGCCCAGGATCTGG - Intergenic
1061759018 9:132837010-132837032 ACCAAACTCAGCCTAAGAATGGG + Intronic
1189493698 X:41490495-41490517 ACCAAATGCTGGCAAAGATAGGG + Intergenic
1189564301 X:42224609-42224631 ACCAAAACCAGGCAAGGATATGG - Intergenic
1191685639 X:63886609-63886631 ACTAAAGGCAGCTAGAGATAAGG + Intergenic
1195273923 X:103260348-103260370 ACCAAAGGCATCCAAAGAGAAGG + Intergenic
1197531356 X:127631128-127631150 ACCAAAGGCAGAGAAAAATATGG + Intergenic
1198442732 X:136679753-136679775 AGCAAAGACAGCCATAGAAAGGG + Intronic