ID: 1081213034

View in Genome Browser
Species Human (GRCh38)
Location 11:40359193-40359215
Sequence ACTGGTATCCTGCTTTTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081213034_1081213038 14 Left 1081213034 11:40359193-40359215 CCTCTCAAAAGCAGGATACCAGT 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1081213038 11:40359230-40359252 AGAATAGCAAGCTATGAATTAGG 0: 1
1: 0
2: 2
3: 23
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081213034 Original CRISPR ACTGGTATCCTGCTTTTGAG AGG (reversed) Intronic
909361145 1:74759976-74759998 ACTGATATCCTACCTTTGACTGG + Intronic
918430686 1:184457290-184457312 ACTGGTTACCTGCTTTCAAGGGG + Intronic
920535313 1:206733337-206733359 CCTGGGATCGTGCATTTGAGGGG + Exonic
921022381 1:211248049-211248071 AATGGAACCCTGCTTTTTAGTGG + Intergenic
1063242109 10:4181392-4181414 CCTGATTGCCTGCTTTTGAGAGG - Intergenic
1066143678 10:32534565-32534587 ACTGGTTTGCTGCTTTTTTGGGG + Intronic
1069182072 10:65374147-65374169 ACTCGTTTCCTTCTTCTGAGAGG + Intergenic
1072172336 10:92877571-92877593 ATTTATATTCTGCTTTTGAGTGG + Intronic
1073817893 10:107227556-107227578 ACTGTCAGCCTGCTGTTGAGGGG - Intergenic
1075687165 10:124372254-124372276 ACTGGTGTCCTGATTTGAAGAGG + Intergenic
1078751088 11:14164305-14164327 ACTGGTATCCTGATATTAAAAGG - Intronic
1078804331 11:14681928-14681950 ACTGATAGCCTGCTGTTGACTGG + Intronic
1081213034 11:40359193-40359215 ACTGGTATCCTGCTTTTGAGAGG - Intronic
1081556444 11:44166810-44166832 ACTAGCATCCTGCTTTTGTTAGG + Intronic
1087697641 11:101398479-101398501 ACATGTATTCTTCTTTTGAGTGG + Intergenic
1088833328 11:113556723-113556745 TCTGGGATGCTGCCTTTGAGGGG - Intergenic
1091700334 12:2654844-2654866 ACCGGGATCCTGCTTCTGACAGG - Intronic
1092588176 12:9921635-9921657 ACTAGTAGCCTGCTGTTGACTGG + Intronic
1097630484 12:62056009-62056031 ACTGAAATCCTGATTTTGAGTGG - Intronic
1098181919 12:67856382-67856404 TCTGGGATCCTGCCTTTGATGGG - Intergenic
1099024868 12:77452735-77452757 CCTTCTATCCTGTTTTTGAGGGG - Intergenic
1100109841 12:91226992-91227014 CCTGGTTTCTTGCCTTTGAGGGG + Intergenic
1101973870 12:109337757-109337779 TCTGGAACCCTGCTTTTGGGAGG + Intergenic
1102459562 12:113091923-113091945 ACTGGTGTCTTGCTGTTGATGGG - Intronic
1102600931 12:114029855-114029877 ACTGGGATGCTGCTTTTCATGGG - Intergenic
1103192721 12:119016050-119016072 ACTGGTATCCTTATGATGAGGGG + Intronic
1108801225 13:54097898-54097920 AATGGAAACCTGCTTTGGAGAGG + Intergenic
1108961975 13:56245868-56245890 ACTGGTAGCAGGCTTTTCAGTGG - Intergenic
1111587477 13:90300577-90300599 ACTAGTATCCTTATTTTTAGCGG - Intergenic
1111599084 13:90448456-90448478 CCTGGTTTCCTGGTTTTCAGAGG + Intergenic
1117425254 14:55588100-55588122 ACTAGTACCCTACTTTTGACTGG + Intronic
1121561296 14:94877930-94877952 ACTGCTATCATGCTTTTGGATGG + Intergenic
1126904192 15:53346887-53346909 ACTTGTATCCTGCCTTGGAAAGG + Intergenic
1127425967 15:58857230-58857252 ACTGGTTTCCTGCCCTTGAAGGG + Exonic
1129240665 15:74250222-74250244 AATGGTAACCTGCCTTTGAAGGG - Intronic
1130334708 15:82949041-82949063 ACTGATAGCCTGCATGTGAGAGG + Intronic
1141099633 16:81187796-81187818 AATGGTATCCTCCTTTTTACAGG - Intergenic
1148018388 17:44538461-44538483 GCTGGTATGCTGCTGGTGAGGGG - Intergenic
1150449710 17:65256638-65256660 ACAGGTTTCCTGCTATTTAGGGG + Intergenic
1150791349 17:68202197-68202219 ACCAGTATCCTGCTCTTGAAAGG + Intergenic
1150866530 17:68856472-68856494 ACTTGCATCGTGGTTTTGAGTGG + Intergenic
1152695177 17:81740713-81740735 CCTGGTCTCCCGCGTTTGAGAGG - Intergenic
1155136891 18:23004703-23004725 AGTGGTCTCCTGCTTCTAAGAGG - Intronic
1157037757 18:43996636-43996658 ATTAGTATCCTGCATTAGAGTGG - Intergenic
1157911974 18:51624896-51624918 ACTGGGTTCCTTCTATTGAGGGG - Intergenic
1159173502 18:64804090-64804112 ACTGCTAAACTGTTTTTGAGTGG - Intergenic
1161411072 19:4117728-4117750 ACTGGATTCCTGCACTTGAGGGG + Intronic
1164762412 19:30737957-30737979 ACTGGTGTCCTTCTTTTGTTAGG + Intergenic
1167375911 19:49111797-49111819 AGTGGTATCATGCTCTAGAGAGG - Intergenic
925681897 2:6431257-6431279 ACTGATTTCCTCTTTTTGAGGGG + Intergenic
928052415 2:28013036-28013058 ACTGGTTACCTTCTTTTAAGAGG + Intronic
935024346 2:99261975-99261997 ACTTACATCCTGCTTTAGAGGGG - Intronic
936016145 2:108960416-108960438 TCTGGTATCCTGTTTTTGGGGGG - Intronic
936780982 2:116031763-116031785 ATTTGTATCCTGCTTAAGAGAGG + Intergenic
940013473 2:149079208-149079230 ACTGGTATCCAGCTTATGGCAGG + Intronic
942722982 2:178973468-178973490 ACTGATGTCTTGCTTTTCAGGGG - Intronic
1173046141 20:39514307-39514329 ATTGGGATCCTGCTTTGGTGGGG + Intergenic
1174741996 20:53023839-53023861 ACTGGTGTGCTGCGTTTCAGTGG - Intronic
1179077328 21:38135071-38135093 ACTGTTTTCCTTCTTTTGAGAGG + Intronic
1179363911 21:40738176-40738198 ATTAGTTTCTTGCTTTTGAGAGG + Intronic
1183728836 22:39605697-39605719 AATGGGGTCCTGCTTTTGATTGG + Intronic
1185097183 22:48816790-48816812 ACTAGTAGCCTGCTGTTGACTGG - Intronic
956286637 3:67617240-67617262 AGTGGAATCCTGTTTGTGAGAGG + Intronic
958472389 3:94537100-94537122 ACTGGTATCCTGATTTTTGGAGG + Intergenic
963127883 3:141832154-141832176 CCTTGCATCCAGCTTTTGAGGGG - Intergenic
966343635 3:178953054-178953076 GCTGGGATCCTGATTTTGAGGGG + Intergenic
968468554 4:765620-765642 ATTGGTTTCCTGCTTCAGAGGGG - Intronic
970079076 4:12259650-12259672 ACTGGGATCTTGCTATTCAGTGG - Intergenic
970840123 4:20458677-20458699 ACTGCTATCCTGCTTCTTACAGG - Intronic
974441572 4:61925085-61925107 ACAGAGATACTGCTTTTGAGGGG - Intronic
981834896 4:149043168-149043190 ACTGGTATGCAGCCTTTGACTGG + Intergenic
982246503 4:153357447-153357469 ACTGATAGCCTGCTGTTGACAGG + Intronic
983599218 4:169505525-169505547 ACTGATATCCTACTGTTGACTGG - Intronic
983782947 4:171696196-171696218 ACTGGTATTTTGCTTTTAAATGG - Intergenic
985036553 4:185846258-185846280 ACTGGCATGATGCATTTGAGAGG - Intronic
985712599 5:1438017-1438039 ACTGGCATCCTGCGCTTGACAGG + Intronic
987823285 5:22993070-22993092 TCTGGTATCAGGCTTTTCAGTGG + Intergenic
990971384 5:61510330-61510352 ACTGGCACTCTGCTTTTGGGGGG + Intronic
996415308 5:123204097-123204119 CCTGCTCTCCTGCTTTTGACAGG + Intergenic
996607080 5:125335757-125335779 ACTGGTATCCCTGTTTAGAGAGG + Intergenic
997690443 5:135824482-135824504 ACTGGTGGCCTGCTGTTGGGAGG - Intergenic
1001102451 5:168825336-168825358 ACTGGAATCCTGCTTTGGACTGG - Intronic
1002828790 6:799794-799816 GCTGCTATACTGCTTTTGAGTGG + Intergenic
1008479946 6:51975795-51975817 AGTGGTCTCCTGCTCTGGAGAGG - Intronic
1009666581 6:66689171-66689193 TCTGGTATCCTGTCTTTGGGAGG - Intergenic
1011588670 6:88949869-88949891 ACTGAAATCCTGCTGTTTAGTGG - Intronic
1014344130 6:120246008-120246030 ACAGGGATCCTGGTTTTGATGGG - Intergenic
1019476903 7:1248698-1248720 ACTGGTGGCCGGGTTTTGAGTGG + Intergenic
1024664048 7:51528290-51528312 ACTAGTATCCTGCTTGTTGGAGG + Intergenic
1030179965 7:106696280-106696302 ACTGGTGTCATTCTTTTGAAAGG - Intergenic
1031968609 7:128047002-128047024 ACTTATATCCTGATTTTGATGGG + Intronic
1034232370 7:149540702-149540724 CCTGGTATCTTTTTTTTGAGAGG - Intergenic
1034436169 7:151063664-151063686 ACTGGCTTCCTGCATTTGAGGGG + Intronic
1039674943 8:39652340-39652362 ATTGTTTTCCTGCTATTGAGTGG - Intronic
1040334020 8:46407007-46407029 GGTGGTTTCCGGCTTTTGAGCGG + Intergenic
1047203652 8:122786271-122786293 AAAGGTATCCTGCTGATGAGTGG - Intronic
1048060322 8:130912888-130912910 AATGGAATCCAGCCTTTGAGAGG + Intronic
1051041807 9:12820577-12820599 TCTGGTATCCCACTTTTGATTGG + Intronic
1055158864 9:73099555-73099577 ACTAGTATCTTGATTTTCAGTGG - Intergenic
1057405774 9:94769508-94769530 ATTGTTTTCCTGCTTTTGAAAGG + Intronic
1058392677 9:104513771-104513793 ACTAGTAGCCTGCTGTTGATTGG - Intergenic
1060143848 9:121234230-121234252 AATGGTATCTTGATTTTGGGTGG + Intronic
1060534450 9:124373027-124373049 ACTGGTGGCCAGCTTTGGAGAGG - Intronic
1060795022 9:126507446-126507468 ACTGCTCACCTGCTTGTGAGAGG + Intergenic
1061872286 9:133527471-133527493 AATGTTTTCCTGCTTTCGAGCGG - Intronic
1186368757 X:8925143-8925165 ACTGATAGCCTACTGTTGAGTGG + Intergenic
1187088677 X:16069918-16069940 ACTGATATCCTTTTTTTGGGGGG + Intergenic
1193870441 X:86790879-86790901 ACTGATAGCCTGCTGTTGACTGG + Intronic
1194933002 X:99912121-99912143 AATGCTATCCCACTTTTGAGAGG + Intergenic
1200299501 X:154958459-154958481 ACTGGTAACCTGCTTTTCCATGG - Intronic