ID: 1081215896

View in Genome Browser
Species Human (GRCh38)
Location 11:40397572-40397594
Sequence TTGGAGGGTCAGGAAGTAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 262}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081215890_1081215896 9 Left 1081215890 11:40397540-40397562 CCCTTTTGTGTCAAAGGGTGACT 0: 1
1: 0
2: 0
3: 14
4: 131
Right 1081215896 11:40397572-40397594 TTGGAGGGTCAGGAAGTAGTTGG 0: 1
1: 0
2: 1
3: 18
4: 262
1081215889_1081215896 10 Left 1081215889 11:40397539-40397561 CCCCTTTTGTGTCAAAGGGTGAC 0: 1
1: 0
2: 1
3: 4
4: 75
Right 1081215896 11:40397572-40397594 TTGGAGGGTCAGGAAGTAGTTGG 0: 1
1: 0
2: 1
3: 18
4: 262
1081215891_1081215896 8 Left 1081215891 11:40397541-40397563 CCTTTTGTGTCAAAGGGTGACTG 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1081215896 11:40397572-40397594 TTGGAGGGTCAGGAAGTAGTTGG 0: 1
1: 0
2: 1
3: 18
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081215896 Original CRISPR TTGGAGGGTCAGGAAGTAGT TGG Intronic
900035354 1:403180-403202 GTGGAGGGACAGAAAGAAGTGGG + Intergenic
900056974 1:638929-638951 GTGGAGGGACAGAAAGAAGTAGG + Intergenic
900242994 1:1625722-1625744 TTGGGGGGTCAGGCAGGACTAGG + Intronic
902625272 1:17672837-17672859 GTGGAGGGTCAGAAATAAGTTGG + Intronic
903217052 1:21849033-21849055 TGGGAGGGTCAGGAGGGAGGAGG + Intronic
903951210 1:26996995-26997017 CTGGAGGGTCAGGCAGGTGTGGG - Intronic
904660047 1:32077282-32077304 CAGGAGGTTCAGGAAGGAGTAGG - Exonic
904829833 1:33299556-33299578 TGGGAGGGGCAGGAAGCAGCCGG + Exonic
906523305 1:46479681-46479703 TTGGAGGCTGAGGAACTAGCAGG + Intergenic
912251288 1:108014989-108015011 TTGGGTGGGCAGGAAGCAGTAGG - Intergenic
912635208 1:111285578-111285600 TTGAAGGATGAGGAAGGAGTTGG + Intergenic
912733800 1:112132647-112132669 GTGGAAGGGCAGGGAGTAGTGGG - Intergenic
915475066 1:156148374-156148396 GTGGAGTGTCAGGAATCAGTGGG + Intronic
915864194 1:159480614-159480636 CAGGAGAGTCAGGAAGTGGTGGG + Intergenic
916837678 1:168564839-168564861 TTGGAGGAACAGGAGGTATTTGG - Intergenic
919415549 1:197304130-197304152 TTGGTGGATCAGAAAGTATTAGG + Intronic
919833479 1:201557938-201557960 TTGGAGGGGCAGAAAGGAGGAGG + Intergenic
920767015 1:208843143-208843165 TTGGTGGTGCAGGCAGTAGTGGG - Intergenic
922257888 1:223908739-223908761 GTGGAGGGACAGAAAGAAGTGGG + Intergenic
922322786 1:224502954-224502976 TTGGAGGGTGAGGGAGGAGGAGG + Intronic
922468160 1:225859121-225859143 TTGGTGGGTGGGGAAGGAGTGGG - Intronic
924339085 1:243011514-243011536 GTGGAGGGACAGAAAGAAGTGGG + Intergenic
1064261709 10:13791505-13791527 GTCCAGGGTCAGGAAGTAGTTGG + Intronic
1067003851 10:42642560-42642582 TTAGAGGGTGAGGGGGTAGTGGG - Intergenic
1067020137 10:42789171-42789193 TTGTAGGGTCAGGAAGAACAGGG - Intronic
1067395793 10:45915654-45915676 GGGGAGGGTGAGGAAGGAGTGGG + Intergenic
1067716402 10:48694207-48694229 TTGGAGGGTGAGGAATCAGATGG + Intronic
1067864114 10:49884777-49884799 GGGGAGGGTGAGGAAGGAGTGGG + Intronic
1069638163 10:69938042-69938064 TTGGAGGGTTTGGAAGTAGTGGG + Intronic
1071601879 10:86962455-86962477 TTGGAGGGGCTGGAGGTATTGGG - Intronic
1071606567 10:86997240-86997262 TTGTAGGGTCAGGAAGAACAGGG - Intergenic
1072235271 10:93448198-93448220 TTGGGGGGTTAGGGAGTAGGGGG - Intronic
1072709407 10:97706268-97706290 GGGGAGGGTCAGGAGGTAGAGGG - Intergenic
1072910567 10:99497269-99497291 TTGGAGGGAAAGGAAGGAGCTGG + Intergenic
1076418590 10:130311035-130311057 GTGAAGGGTCAGGAAGGAATGGG + Intergenic
1076943408 10:133625701-133625723 TGAGATGGTCAGGAAGGAGTGGG - Intronic
1077925582 11:6679459-6679481 TTAGAGGCAAAGGAAGTAGTTGG + Intergenic
1078919518 11:15816502-15816524 GTGGAGGGGCAGGAAGGTGTTGG + Intergenic
1081215896 11:40397572-40397594 TTGGAGGGTCAGGAAGTAGTTGG + Intronic
1083728741 11:64642231-64642253 GGGGAGGGTAAGGAAGTAGAAGG + Intronic
1085987936 11:81807892-81807914 TTGGAGGCTGAGGAAGAATTGGG - Intergenic
1086860854 11:91923323-91923345 TTGGAGGGACAGGATGTGTTGGG - Intergenic
1087196833 11:95311235-95311257 GTGGAGGCTGAGGAAGTATTGGG - Intergenic
1091702986 12:2676305-2676327 TTGGAGGGACAGGTAGGAGGAGG + Intronic
1093053805 12:14534432-14534454 TTGGAGGGTCTGGAAATTCTTGG + Intronic
1095513004 12:42974217-42974239 TTTGGGTGGCAGGAAGTAGTGGG + Intergenic
1096589095 12:52645364-52645386 TTGGAGGTTCTGGAGGTAGAGGG - Exonic
1096988384 12:55777763-55777785 TTGGAGGATTAGGGAATAGTGGG + Intronic
1099285561 12:80710539-80710561 TTGGAGGGTTAGGAAGGAAAGGG - Intergenic
1100245926 12:92756970-92756992 TTGGAGGGGCAGGAAGGATGAGG + Intronic
1100286582 12:93172630-93172652 TTGGAGGGACAGAAGGAAGTGGG - Intergenic
1100473355 12:94913376-94913398 AAGGAGGGACAGGAAGTGGTTGG + Intronic
1102031571 12:109743059-109743081 GTGGGAGGTCAGGAAGTGGTGGG + Intronic
1102230285 12:111257370-111257392 TGGGAGGGGGAGGAAGAAGTGGG - Intronic
1102230292 12:111257389-111257411 TGGGAGGGGGAGGAAGAAGTGGG - Intronic
1102230299 12:111257408-111257430 TGGGAGGGGGAGGAAGAAGTGGG - Intronic
1102230306 12:111257427-111257449 TGGGAGGGGGAGGAAGAAGTGGG - Intronic
1102230313 12:111257446-111257468 TGGGAGGGGGAGGAAGAAGTGGG - Intronic
1102230320 12:111257465-111257487 TGGGAGGGGGAGGAAGAAGTGGG - Intronic
1103005981 12:117420691-117420713 TAGGAGGGTCAGTAAAGAGTGGG - Intronic
1110389634 13:74959306-74959328 GTGGAGCGTCAGGAAGTACAAGG + Intergenic
1112115705 13:96350876-96350898 TTGGATGGACAGGAAGCAATGGG - Intronic
1116698876 14:48212264-48212286 TTGTAGTTTCAGGAAGGAGTGGG - Intergenic
1117096860 14:52307672-52307694 CTGGAGTATCAGGAAGTACTGGG - Intergenic
1117488863 14:56226198-56226220 TTGCTGGGTCAGGCAGTGGTGGG - Intronic
1117640501 14:57793399-57793421 TTGGAGGCTCAGAAGGTAGAAGG - Intronic
1119668136 14:76499164-76499186 AGGTAGGGTCAGGAAGTAGCGGG - Intronic
1120036221 14:79701601-79701623 TTCCAGGGGCAGGAAGTAGAGGG + Intronic
1120053937 14:79900018-79900040 TTGCAGGGCCAGGAGGAAGTGGG - Intergenic
1121445865 14:93978398-93978420 TTTATGGGTCAGGAAGTTGTGGG - Intergenic
1121729463 14:96176208-96176230 TTGCAGGATCTGGAAGTAGTAGG - Intergenic
1122586173 14:102808101-102808123 TTGGATGGACAGGAAGTGGGAGG + Intronic
1126106281 15:45149006-45149028 CTGGTGGGGCAGGAAGTAGGGGG - Intronic
1127570436 15:60236156-60236178 TTAGAGGTTCAGGAAGTGGCTGG + Intergenic
1128073278 15:64810591-64810613 GTGGAGGGACAGCAGGTAGTGGG + Intergenic
1129444409 15:75606757-75606779 TTTCAGGGTCAGGATGTGGTTGG + Intronic
1129487535 15:75889553-75889575 TTGGAAGGGTAGGAAGCAGTAGG + Intronic
1129884982 15:79031483-79031505 ATGGAGGGTCAGGATGTACCTGG + Exonic
1130397284 15:83513675-83513697 ATGGAGGGTCATGATTTAGTGGG - Intronic
1134072942 16:11272042-11272064 TTTGTGGGTCTGGGAGTAGTGGG + Intronic
1135334331 16:21587974-21587996 TTGGAGGGTGAGGAGGAGGTTGG + Intergenic
1135783257 16:25324888-25324910 TTGGAGGGTAGGGCAGTAGCAGG + Intergenic
1135875909 16:26199961-26199983 TTGGAGGGTGGGGTAGTAGGAGG - Intergenic
1136233314 16:28900474-28900496 GTGAAAGGTCAGGAAGTGGTGGG - Intronic
1139327485 16:66163685-66163707 TTGGAGGGAGAGGGAGTGGTAGG + Intergenic
1141347424 16:83260344-83260366 GTGGAGGGACAGGAATGAGTGGG + Intronic
1141347590 16:83261475-83261497 GTGGAGGGACAGGAATGAGTGGG + Intronic
1141651698 16:85396316-85396338 TTGGAGAGACAGGAAATATTAGG + Intergenic
1141769094 16:86078080-86078102 TTGGAAGCTCAGGAAGAGGTAGG - Intergenic
1141774676 16:86115327-86115349 TTCAAGGGTCAGGAAGAAGGTGG + Intergenic
1141986396 16:87583007-87583029 TTGGAGGCTCAGGAGGAGGTGGG + Intergenic
1142201145 16:88761721-88761743 GGGGAGGGTCAGGAGGAAGTGGG - Intronic
1142373713 16:89696455-89696477 TTCCAGGGTCAGGGAGTTGTGGG + Exonic
1142467082 17:142170-142192 TTGGACGGGCATGAAGTAGGTGG + Intergenic
1142666719 17:1467695-1467717 TTGGGGGGTCAGGAGGTGGATGG - Intronic
1143136020 17:4712687-4712709 TGGGAGGGTAAGGAAGTGTTTGG - Intronic
1143335932 17:6171484-6171506 TTGGAGGTTGAGGAAGGAGTTGG - Intergenic
1144353570 17:14422897-14422919 TTGGAGGGTTGGGAAGATGTTGG + Intergenic
1144613757 17:16749726-16749748 TTGGTAGGTCTGGAAGTACTTGG + Intronic
1144772843 17:17769470-17769492 CTGGAGGAGCAGAAAGTAGTAGG + Intronic
1144898956 17:18565940-18565962 TTGGTAGGTCTGGAAGTACTTGG - Intergenic
1145133421 17:20379779-20379801 TTGGTAGGTCTGGAAGTACTTGG + Intergenic
1145218240 17:21068317-21068339 TTGGAGGAGCTGGAAGGAGTGGG - Intergenic
1146945358 17:36869776-36869798 TTCGACGGAGAGGAAGTAGTGGG - Intergenic
1148594092 17:48838956-48838978 TTTAAGGGGCAGGAAGTATTAGG + Intronic
1148727769 17:49807695-49807717 ATGGAAGTTCAGGCAGTAGTTGG + Intronic
1150232819 17:63567198-63567220 TTTGAGGGTCAGTAAGCAGATGG + Intronic
1150343996 17:64390243-64390265 TTGGCTGGTCTGAAAGTAGTGGG - Intronic
1150979697 17:70127284-70127306 TTAGAGAGTCAGGGAGTATTTGG + Intronic
1151917155 17:77126804-77126826 TGGGTGGGTCAGGCAGGAGTGGG + Intronic
1152262753 17:79275759-79275781 ATGGATGGTCAGGAAGCAGGAGG + Intronic
1153340267 18:3966262-3966284 TTGGTGGGTGGGGAAGTAGTAGG + Intronic
1157840157 18:50950065-50950087 TTAGAGTGTCAGTAAGTAGTAGG + Exonic
1158907606 18:62029136-62029158 TTGAAGGGACAGGAAAGAGTGGG + Intergenic
1159022991 18:63158202-63158224 TTGGGGAGTGAGGAAGTAATAGG + Intronic
1159194116 18:65088956-65088978 TTGGAGGGACAGATAGTATTAGG + Intergenic
1160864032 19:1249423-1249445 CGGGAGGGGCAGGAAGTCGTGGG - Intronic
1162721627 19:12666269-12666291 TTGGAGGGGCAGGAGGTGGCAGG - Intronic
1163422275 19:17220465-17220487 TTGGAGGGTCGGGGAGGAGTGGG + Intergenic
1164513782 19:28917565-28917587 TTGGAGTGTCAGGAAGGGTTAGG + Intergenic
1165041029 19:33067577-33067599 TTCAAGGATCAGGAAGTTGTGGG + Intergenic
1165213231 19:34251937-34251959 ATGGAGGGTGAGGAAGAGGTAGG - Intergenic
1166254434 19:41592289-41592311 TTGGAGGGTGAGGAGGAGGTGGG - Intronic
1166416267 19:42596540-42596562 TTGGAGGGTAAGGAGGACGTGGG + Intronic
1167523948 19:49972348-49972370 TTGGAGGATCAGGGAGCTGTTGG - Intergenic
926355715 2:12038988-12039010 ATGGAGGGGCAGGAAGTCCTAGG + Intergenic
926402814 2:12516113-12516135 TGGAAGAGTCAGGAAGGAGTAGG - Intergenic
927657238 2:24959604-24959626 TTTGAAGGTCAGGAGCTAGTGGG - Intronic
927839208 2:26427703-26427725 GTGGAGGGTCAGGGAGGAATGGG - Intronic
928876494 2:36046133-36046155 TTAGAGGGTAAGGAAGTAAGGGG - Intergenic
931747246 2:65301047-65301069 TTGGCGGGGAAGGAAGCAGTGGG - Intergenic
932104012 2:68926569-68926591 TTGCAGGGGCAGGCGGTAGTAGG + Intergenic
932404459 2:71504094-71504116 TGGGTGAGTCAGGAAGTAGCCGG + Intronic
933443915 2:82352855-82352877 TAGGAGGGTTGGGGAGTAGTGGG + Intergenic
935418655 2:102844349-102844371 CTGGAGGGTCAGGAGGCAATAGG + Intergenic
938389879 2:130896752-130896774 TAGAAGGGCCAGGAAGAAGTAGG + Intronic
938734485 2:134173892-134173914 TTAGAGAGTGAGGAAATAGTTGG + Intronic
942447095 2:176085440-176085462 TTGGAGGGTCAGGGAAGGGTGGG - Intergenic
942564744 2:177255276-177255298 TGGGAGGATCAGGAAGGAGGGGG - Intronic
942853112 2:180513928-180513950 TTGTAGGGTCAGGAAGAATAGGG - Intergenic
943756255 2:191560325-191560347 TTGGAGAGCCAGGCATTAGTGGG + Intergenic
945783930 2:214210119-214210141 TTAGAGGGTAAGGAAGAAGTTGG + Intronic
946039386 2:216770759-216770781 TGTGAGGGTGAGGAAGGAGTTGG + Intergenic
946184931 2:217975307-217975329 TTGGGGGGTCAGGATGTTGGGGG - Intronic
946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG + Intronic
946712280 2:222518508-222518530 TTGGTGAGTGAGGAAGAAGTAGG + Intronic
947721904 2:232374970-232374992 TTGGTGGGGAAGGAAGAAGTGGG + Intergenic
949086314 2:242158737-242158759 GTGGAGGGACAGAAAGAAGTGGG - Intergenic
1169413136 20:5391736-5391758 TGGGAGGTCCAGGATGTAGTGGG + Intergenic
1169742714 20:8912776-8912798 TTGGAGGGAGAGGAAGAAGTTGG - Intronic
1171780781 20:29415863-29415885 TGAGATGGTCAGGAAGGAGTGGG - Intergenic
1172032069 20:31989293-31989315 CTGGAGTGTCAGGAACAAGTGGG + Intronic
1172069610 20:32246952-32246974 TTGGAGGTTGAGGCTGTAGTGGG - Intergenic
1172321586 20:33999188-33999210 GTGGAGGGTAAGGAAGGAATCGG + Intronic
1174183004 20:48686809-48686831 GTGGAGGGGCAGCAAGTAGAAGG - Intronic
1176974617 21:15305913-15305935 TTGGAGGGACAGGAAAGAGGAGG - Intergenic
1177096365 21:16839060-16839082 TTGGAGGATGAGTAAATAGTAGG - Intergenic
1177301890 21:19257379-19257401 TTGGAGGGACAGGAGGCAGGAGG + Intergenic
1178042811 21:28659015-28659037 TTTGACAGTCAGGAAGTAGCTGG - Intergenic
1179250149 21:39665254-39665276 GTGGAGGGGCAGGAGGTGGTTGG - Exonic
1179592479 21:42418294-42418316 TTGGAGGGGCAGAAAGCAGGAGG + Intronic
1179834353 21:44019731-44019753 TTTGAGGGTTAGGATGTTGTGGG + Intronic
1180560823 22:16612966-16612988 GTGGAGGCTGAGGAAGTATTGGG - Intergenic
1180721801 22:17914990-17915012 TTAGTGGGTCAGGAAGGTGTGGG - Intronic
1181918126 22:26297021-26297043 CTGGAAGGTCCGGAAGTAGACGG - Exonic
1182208144 22:28649196-28649218 TTGGAGACTCAGGAGGTAGGAGG + Intronic
1183718179 22:39546541-39546563 CTGGAGGGTCAGGATGCAGGGGG + Intergenic
1184338775 22:43873842-43873864 TTGGAGGGCCAAGAAGAAGACGG + Intergenic
949232374 3:1766438-1766460 GTGGGGGGTCAGGAAGTGGGAGG + Intergenic
953930641 3:47004182-47004204 TGGGAAGTTGAGGAAGTAGTTGG - Exonic
955957815 3:64308690-64308712 TTGGAGCCTGAGGGAGTAGTAGG - Intronic
957084225 3:75665408-75665430 TGAGATGGTCAGGAAGGAGTGGG + Intronic
960363268 3:116740216-116740238 TTTGAGGATAAGGAAGAAGTTGG - Intronic
960718195 3:120598582-120598604 TTGGAGTGTGTGTAAGTAGTAGG + Intronic
961924863 3:130467907-130467929 TTGGAAAGACAGGAAGTAGATGG - Intronic
962409681 3:135130014-135130036 TTGGATAGTCAGGAAGCAGGGGG + Intronic
963565606 3:146926381-146926403 TGGGAGTGTCAGGAAGAATTGGG - Intergenic
964936066 3:162089502-162089524 ATGGAGAGTCAGGGAGAAGTAGG - Intergenic
965046917 3:163590103-163590125 CTGGAGGGTCAACAATTAGTTGG + Intergenic
966097262 3:176219368-176219390 TTGGAGGGAAAGGCAGAAGTGGG - Intergenic
966279216 3:178209210-178209232 TTGGAGGCTGAGGAAGAATTGGG - Intergenic
967094496 3:186165640-186165662 AAGGAGGGGCAGGAAGTAGGAGG + Intronic
967802064 3:193673095-193673117 ATGGAGGGTTAGGAACTCGTAGG + Intronic
968356439 3:198111250-198111272 TGAGATGGTCAGGAAGGAGTGGG + Intergenic
971226627 4:24759466-24759488 CTGGAGGGACAGGAAGTTGGGGG + Intergenic
971663142 4:29446546-29446568 TTGGGGGAACAGGAAGTATTTGG - Intergenic
971813483 4:31458669-31458691 TTGGAACATCAGGAAGTAGTGGG - Intergenic
972859251 4:43147042-43147064 TTTTAGGGCAAGGAAGTAGTTGG + Intergenic
973554060 4:52064423-52064445 TTGGAGGGAAAGGAAGGAGGAGG - Intronic
975578956 4:75889989-75890011 TTGCATGGTCAGGCAGGAGTGGG + Exonic
975860192 4:78668869-78668891 TAGGAGGTTCAGGAATCAGTTGG - Intergenic
977494634 4:97759562-97759584 TTGCAAGGTCAGGAAGTAAGGGG + Intronic
978588317 4:110296527-110296549 TTGAAGGGGCAGGGAGTGGTGGG + Intergenic
979238034 4:118423720-118423742 GTGGAGGGACAGAAAGAAGTGGG - Intergenic
980175234 4:129336478-129336500 TTAGAGATTCAGGAGGTAGTTGG + Intergenic
982396214 4:154918514-154918536 GTGGAGGGTCATGAAGTGCTCGG + Intergenic
982812293 4:159841056-159841078 TTGGAGGTTCAGAAAGGAGGAGG - Intergenic
982840590 4:160180115-160180137 TTAGAGGGAGATGAAGTAGTGGG + Intergenic
983665667 4:170179636-170179658 TTGGAGGGTCTGCAAGCAATAGG + Intergenic
983732123 4:171008695-171008717 TTGGAGACTCAGGAATTTGTAGG + Intergenic
985446762 4:190026163-190026185 TGAGATGGTCAGGAAGGAGTGGG - Intronic
986548579 5:8926834-8926856 GTGGGGGGTCAGGAGGAAGTAGG + Intergenic
987109649 5:14673098-14673120 TTGTGGGGTCAGGAAGCAGGAGG + Intronic
987995203 5:25267960-25267982 TTGGAAGATCAGGTAGTTGTAGG + Intergenic
988738353 5:34044979-34045001 TTGGAGGGTGAGCAAGTGGATGG + Intronic
990430596 5:55731782-55731804 TTGAAAGGTGAGGAAGTAGAAGG + Intronic
990475291 5:56156620-56156642 TTGGAGGTGGAGGAAGTAGTTGG + Intronic
991526129 5:67560104-67560126 TTGGAGGGACAGAAATTAGAAGG + Intergenic
992135065 5:73736365-73736387 CTGGAGGGTCAGGAAGAAGCAGG - Intronic
995653243 5:114395819-114395841 TTGGAAGGTCAGGACGTAAGAGG - Intronic
995940469 5:117576353-117576375 TTGGAGAGTCAGGAAGGCATAGG + Intergenic
998673813 5:144384319-144384341 CTGGAGGCTAAGGAAGAAGTGGG + Intronic
1001818417 5:174690708-174690730 TGGGAGAGCCAGGAATTAGTTGG - Intergenic
1002738465 5:181415691-181415713 GTGGAGGGACAGAAAGAAGTGGG - Intergenic
1004555963 6:16698329-16698351 TGGGAGGGGCAGGGAGTGGTTGG - Intronic
1005068768 6:21844853-21844875 TTAGAGGGTGAGGAAGTACTAGG + Intergenic
1005958614 6:30681355-30681377 TTAGAGGGTCAGGAGGTAGGGGG - Intronic
1006004931 6:30994034-30994056 ATGTAGGGGCAGGAAGTTGTAGG - Intergenic
1007091677 6:39188721-39188743 TTTGAGAATCAGGAAGGAGTGGG - Intergenic
1008200933 6:48589273-48589295 GTGGAGGCCCAGGAAGCAGTGGG + Intergenic
1008436147 6:51478822-51478844 TTGGAGGAGCAGGAAGTAAAGGG + Intergenic
1009772107 6:68156938-68156960 TTGGTGGGTCAGGACTAAGTAGG - Intergenic
1009836638 6:69009539-69009561 TTGGAGAGACAGGAAGTGGCTGG + Intronic
1012603630 6:101130540-101130562 TTGGAGGGTCATGATGTGTTGGG + Intergenic
1013658145 6:112266608-112266630 TTGAGGGGGCAGGAAGTAGGAGG + Intergenic
1018386627 6:163310312-163310334 GTGGAGGCTCTGGAAGCAGTGGG + Intronic
1018968642 6:168509056-168509078 TTGGCCGGTCAGGAAGTGGCAGG + Intronic
1019243568 6:170691244-170691266 GTGGAGGGACAGAAAGAAGTGGG - Intergenic
1021617528 7:22518234-22518256 TTAGGGGCTCAGGAAGTAGAAGG - Intronic
1022693490 7:32681575-32681597 TTAGGGGCTCAGGAAGTAGAAGG - Intergenic
1022927119 7:35067717-35067739 TTAGGGGCTCAGGAAGTAGAAGG - Intergenic
1023587275 7:41743838-41743860 TGGGAGGGGTAGGGAGTAGTGGG - Intergenic
1024613434 7:51086462-51086484 TTGGAAGGCCAGGAAGTACTTGG - Intronic
1024850958 7:53716433-53716455 AAGGAGGGTGAGGAAGAAGTTGG - Intergenic
1028923576 7:96332761-96332783 TTGGAGGGGCAGGATGGAGTAGG + Intergenic
1029311144 7:99666116-99666138 TTGGAGGAAAAGGAAGTAGTGGG + Intronic
1031395205 7:121265310-121265332 TTTGAGGGTCAGGAAGATGGAGG - Intronic
1032748738 7:134814566-134814588 TTGGAGGCTTGGGAAGGAGTTGG + Intronic
1033305379 7:140221708-140221730 TTGAAGGCTCAGGAAGTGGCTGG - Intergenic
1034974778 7:155441650-155441672 TCGCAGGGTGAGGAAGTGGTAGG - Intergenic
1035236913 7:157503226-157503248 TTGGAGGGGCACGCAGCAGTTGG + Intergenic
1035481512 7:159190975-159190997 ATCGAGGGTCAGGAAGGACTGGG + Intergenic
1035504554 8:116914-116936 GTGGAGGGACAGAAAGAAGTGGG + Intergenic
1035583298 8:753610-753632 ATGGAGAGGGAGGAAGTAGTTGG + Intergenic
1041523441 8:58779345-58779367 TTAGAGGCACAGGAAGTATTAGG - Intergenic
1043258391 8:78164032-78164054 TTGGAAGGCCAGAAAGCAGTGGG + Intergenic
1043543924 8:81294397-81294419 TTGGAGGGTCAGGAATTTCCAGG - Intergenic
1043711625 8:83425957-83425979 TGGCAGGGACAGGAAGTATTGGG + Intergenic
1045675508 8:104603412-104603434 CTGGAGACTCAGGAAATAGTTGG + Intronic
1046411844 8:113855211-113855233 TTGGAGGGTAAAGAAATTGTGGG - Intergenic
1048164453 8:132050182-132050204 CTGAAGGGTCTGGAAGCAGTTGG + Intronic
1049203334 8:141352154-141352176 GTGGGGGGTCAGGATGTAGGGGG + Intergenic
1051052541 9:12950022-12950044 GTGGAGGCTGAGGAAGTATTGGG - Intergenic
1051854241 9:21544479-21544501 TTGGAGGCTCAAGAGGGAGTGGG - Intergenic
1052185391 9:25587708-25587730 TGGGAAGGATAGGAAGTAGTAGG + Intergenic
1053495354 9:38545026-38545048 TTGCAGTGTCAGGAAGCAGAGGG - Intronic
1055257937 9:74394467-74394489 TTGGAAGGACAGGAAGAATTTGG - Intergenic
1056024712 9:82481754-82481776 TTGGAGTTTCAGAAAGTAGATGG - Intergenic
1058052423 9:100420351-100420373 GTGGCGGGTCAGGAAGTCGTGGG - Intergenic
1059942399 9:119370352-119370374 ATGGAGGGGCAGGAAGTCATAGG + Intergenic
1060437323 9:123605194-123605216 TGGGATGGTCAGGAAGGAGAAGG - Intronic
1061487174 9:130925759-130925781 GTGGAGGGTGAGGGGGTAGTGGG + Intronic
1061609373 9:131736312-131736334 TTGGAGGGCCAGGAACAAGCTGG - Intronic
1203603757 Un_KI270748v1:40467-40489 GTGGAGGGACAGAAAGAAGTGGG - Intergenic
1186350251 X:8732409-8732431 TGGGAGGGGCAGGAAGCGGTTGG - Intergenic
1186667396 X:11731709-11731731 ATGGAGGGTTGGGAAGTTGTTGG + Intergenic
1187194572 X:17070858-17070880 GTGGAGGGAGAGGAAGGAGTTGG + Intronic
1188738632 X:33749636-33749658 TTGGAGAGACAGCCAGTAGTGGG + Intergenic
1192542969 X:71990641-71990663 CTGGAGGCACAGAAAGTAGTAGG - Intergenic
1193024891 X:76835881-76835903 TTGGTAGGTCTGGAAGTACTTGG + Intergenic
1194429695 X:93786144-93786166 TGGGAGGGTCAGGGGGTAGGTGG - Intergenic
1194746239 X:97631374-97631396 GTAGAGGGTCAGGAAGGAGTAGG + Intergenic
1197131391 X:123009505-123009527 TTAGGAGGTCAGGGAGTAGTAGG + Intergenic
1199622548 X:149713326-149713348 TTGGGGTGTCAGCAAGGAGTGGG + Intronic
1199800444 X:151246252-151246274 TTGGAGGGGTAAGAAGTAGAAGG + Intergenic
1200335084 X:155342014-155342036 TGGGAGGGTGAGGAGGAAGTGGG - Intergenic
1200351384 X:155499207-155499229 TGGGAGGGTGAGGAGGAAGTGGG + Intronic
1201253734 Y:12087101-12087123 TTGGAGGGTCTGGAGGAGGTTGG - Intergenic
1201387066 Y:13452740-13452762 ATGGAGGCTCAGGGATTAGTAGG + Intronic
1201416166 Y:13751450-13751472 TAGGAGGGGCAGGAAGCGGTTGG + Intergenic
1202385817 Y:24325519-24325541 GTGGAGGGACAGAAAGAAGTGGG - Intergenic
1202484969 Y:25344609-25344631 GTGGAGGGACAGAAAGAAGTGGG + Intergenic