ID: 1081223285

View in Genome Browser
Species Human (GRCh38)
Location 11:40489422-40489444
Sequence TACTCACAACTCTCTGGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 192}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081223279_1081223285 0 Left 1081223279 11:40489399-40489421 CCCTCTTTCCTCACCTACACGCA 0: 1
1: 0
2: 1
3: 22
4: 209
Right 1081223285 11:40489422-40489444 TACTCACAACTCTCTGGGTCAGG 0: 1
1: 0
2: 0
3: 20
4: 192
1081223278_1081223285 12 Left 1081223278 11:40489387-40489409 CCACTTTCATAACCCTCTTTCCT 0: 1
1: 0
2: 1
3: 42
4: 431
Right 1081223285 11:40489422-40489444 TACTCACAACTCTCTGGGTCAGG 0: 1
1: 0
2: 0
3: 20
4: 192
1081223280_1081223285 -1 Left 1081223280 11:40489400-40489422 CCTCTTTCCTCACCTACACGCAT 0: 1
1: 0
2: 0
3: 20
4: 224
Right 1081223285 11:40489422-40489444 TACTCACAACTCTCTGGGTCAGG 0: 1
1: 0
2: 0
3: 20
4: 192
1081223281_1081223285 -8 Left 1081223281 11:40489407-40489429 CCTCACCTACACGCATACTCACA 0: 1
1: 0
2: 4
3: 95
4: 1108
Right 1081223285 11:40489422-40489444 TACTCACAACTCTCTGGGTCAGG 0: 1
1: 0
2: 0
3: 20
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081223285 Original CRISPR TACTCACAACTCTCTGGGTC AGG Intronic
900170499 1:1266001-1266023 TCCCCACAAATCTGTGGGTCAGG - Intronic
904285435 1:29450557-29450579 TGCTTACAATTTTCTGGGTCAGG - Intergenic
904594708 1:31636072-31636094 CACTCACAACTCTGTGAGGCAGG + Intronic
906634576 1:47400281-47400303 GACTCACAACTCTGAAGGTCAGG + Intergenic
907107306 1:51895554-51895576 TACTCACACCACTCTGTGTGCGG + Intergenic
907732669 1:57082944-57082966 TACTCCTGACTCTCTGGGCCAGG + Intronic
909214660 1:72871155-72871177 TAGTCACAAATCTGTGGCTCAGG - Intergenic
910003754 1:82368756-82368778 TTCTTACAATTCTGTGGGTCAGG - Intergenic
910808244 1:91210244-91210266 TAGGCAGAACTCTCTAGGTCAGG - Intergenic
912861412 1:113217081-113217103 TCCTAACAACCCTCTGGGTTGGG - Intergenic
914044612 1:144080293-144080315 TAGTTAAATCTCTCTGGGTCAGG - Intergenic
914133498 1:144880393-144880415 TAGTTAAATCTCTCTGGGTCAGG + Intergenic
914383430 1:147142285-147142307 TAATCAAAACTCTATGGGACTGG - Intergenic
915060150 1:153175044-153175066 TTCTAACAATTCCCTGGGTCTGG - Intergenic
917660549 1:177173103-177173125 TACACACAACTGTGTGAGTCAGG - Intronic
918923067 1:190741094-190741116 TCATCACAACTCTCTGAGACTGG - Intergenic
920798285 1:209161714-209161736 TATTCACATCTTTCTGGGCCTGG - Intergenic
1063965803 10:11344806-11344828 GGCGCACAACTCTCTGGGACCGG + Intergenic
1064369496 10:14738894-14738916 TGCTCACAACTTTGTGGGTCAGG + Intronic
1065111198 10:22441823-22441845 CACTCACAATTCTTTGGGTTAGG + Intronic
1066956740 10:42179980-42180002 TAGTTAAATCTCTCTGGGTCAGG - Intergenic
1067712951 10:48664889-48664911 TTCTCACAATTCTGTGGGACAGG - Intergenic
1067729187 10:48796947-48796969 TACTGAGCACCCTCTGGGTCAGG + Intronic
1070755159 10:78987574-78987596 GGCTCACCTCTCTCTGGGTCAGG - Intergenic
1072578786 10:96722299-96722321 TCTTCACAAGTCTCTGGGCCTGG + Intergenic
1077141928 11:1028536-1028558 TTCACACAACCCTCTGTGTCCGG - Intronic
1077285193 11:1762464-1762486 TACTCTCAAGTCCCTGGGGCAGG - Intronic
1079367116 11:19819180-19819202 TACTCACATCTCTCTCAATCAGG - Intronic
1079573166 11:21969889-21969911 TGCTCACAATTCTGTGTGTCAGG + Intergenic
1080277997 11:30524540-30524562 TCCTCACAACACTCTGAGGCTGG - Intronic
1081223285 11:40489422-40489444 TACTCACAACTCTCTGGGTCAGG + Intronic
1084978393 11:72815520-72815542 GACTCACAGCTCCCTGGGTCGGG - Intronic
1086955677 11:92932585-92932607 TACTCACAATTCTATGAGGCAGG - Intergenic
1088224218 11:107601777-107601799 TATTCACAACTCTGTTGGTTTGG - Intronic
1089129859 11:116203098-116203120 TAAACACAACTGTCTGTGTCTGG + Intergenic
1093715903 12:22381318-22381340 TACTGACAATTCTCTGAGTATGG - Intronic
1094042248 12:26130379-26130401 TACTGACAACTCTCTGCACCAGG - Intronic
1100262188 12:92942660-92942682 TACTCATGTCTCTCTGGGCCTGG + Intergenic
1100812148 12:98349873-98349895 TCCTCACAACACTCTGAGACTGG + Intergenic
1101009443 12:100434340-100434362 TTCTCACAATTCTGTGGGTTGGG + Intergenic
1101326294 12:103718687-103718709 TTCTCAAAACTCTCTATGTCTGG - Intronic
1102800876 12:115732632-115732654 TTCTCACTATTTTCTGGGTCAGG + Intergenic
1103077908 12:117999743-117999765 TGCTCATAAGTCTGTGGGTCTGG + Intergenic
1104655106 12:130568466-130568488 TGCTCACGGCTCTCTGGGACTGG - Intronic
1105323109 13:19346150-19346172 TACACACAGCTGTCTGGGTGTGG - Intergenic
1105874280 13:24539717-24539739 TACACACAGCTGTCTGGGTGTGG + Intergenic
1107262752 13:38514753-38514775 ACCTCACAACTCTCAGGGACAGG - Intergenic
1111707140 13:91764413-91764435 TACTCAGACCTTTCTGAGTCTGG - Intronic
1114647721 14:24264736-24264758 CACTCAGGACTCTCTAGGTCAGG + Intergenic
1115710757 14:36048665-36048687 TGCTCACAATTTTATGGGTCAGG + Intergenic
1117928515 14:60812332-60812354 TGCTCACAATTCTGTGGGTTAGG + Intronic
1119670025 14:76511230-76511252 TACCCACAACTCTTTGGGAATGG + Intergenic
1119849794 14:77859038-77859060 CACTCACACCTCTCTGGTCCTGG + Intronic
1122247359 14:100413281-100413303 TACCCAGAACACTGTGGGTCAGG - Intronic
1122422423 14:101586011-101586033 TAGTCACAACTCTGTAGGGCTGG + Intergenic
1202936378 14_KI270725v1_random:91780-91802 TAGTTAAATCTCTCTGGGTCAGG + Intergenic
1124472171 15:29997691-29997713 TGCTCACAATTCTGTGGGTCAGG + Intergenic
1128281962 15:66403082-66403104 AATTCACACCTCTCTAGGTCTGG - Intronic
1128441863 15:67717603-67717625 TACTCAGGATTCTGTGGGTCAGG + Intronic
1129526758 15:76222708-76222730 AAATCACATCTCTCTGGGACAGG + Intronic
1130377526 15:83342909-83342931 TAATCTCAACACTCTGGGTAGGG + Intergenic
1132762112 16:1513975-1513997 TTCTCACAACTTTCTGCCTCAGG + Intronic
1134098056 16:11432267-11432289 TGCTCACGATTCTGTGGGTCAGG - Intronic
1134691591 16:16194122-16194144 CACTCAAAACTCTCAGGGTCAGG - Intronic
1138420357 16:56894917-56894939 AAGTCACAAATCTCTGGGTTTGG + Intronic
1139676101 16:68524664-68524686 TGCTCACAGCTGTGTGGGTCTGG + Intergenic
1139965214 16:70741574-70741596 AATCCACAACTCTCTGGGCCAGG - Intronic
1143560792 17:7693381-7693403 TTCTCACAACTCTGTGAGGCAGG - Intronic
1144847485 17:18227468-18227490 GCCTCACAACTCCCTGGCTCAGG + Intronic
1146210412 17:30938144-30938166 TTCTCACAATCCTATGGGTCAGG + Intronic
1149340682 17:55682982-55683004 TCCTCACAGCTCTCTGCCTCAGG - Intergenic
1149693187 17:58595781-58595803 TTCTCACAATTCTGTGGGTCAGG - Intronic
1150363058 17:64554682-64554704 TTCTCACAATTCCATGGGTCAGG - Intronic
1150416692 17:64994290-64994312 TGCCCACAAATCTGTGGGTCTGG - Intergenic
1150657264 17:67047523-67047545 TAATGACAACTCTCTGGGAATGG - Intronic
1150794963 17:68229591-68229613 TGCCCACAAATCTGTGGGTCTGG + Intergenic
1154376377 18:13813476-13813498 GAGTCACAACTCTCTGGGCTGGG + Intergenic
1155032976 18:22000673-22000695 TCCTCACGAGTCCCTGGGTCAGG + Intergenic
1156891735 18:42198162-42198184 TTTTCACAACTCTTTGGGTGGGG + Intergenic
1158569627 18:58586622-58586644 TAATGACAACTCTCTGGGTATGG - Intronic
1159275171 18:66209938-66209960 TACTCACAACTCTTGGGATTAGG + Intergenic
1163507874 19:17719129-17719151 TGCTCCCAGCTCTCTAGGTCAGG - Intergenic
1164484210 19:28640821-28640843 TACACACAATTCTGTGAGTCAGG + Intergenic
1166320408 19:42014757-42014779 TACTCACCACACACTTGGTCAGG + Intronic
1202684171 1_KI270712v1_random:33712-33734 TAGTTAAATCTCTCTGGGTCAGG - Intergenic
926969170 2:18449770-18449792 TCCTCACAATTCTAAGGGTCAGG - Intergenic
927225806 2:20765549-20765571 TTCTCACAATTCTGTGGGTCAGG + Intronic
927811131 2:26180770-26180792 TACAAAAAACTCTCTGGGTGTGG - Intronic
928458230 2:31444332-31444354 CACCCACAACTCTTTGAGTCTGG + Intergenic
932609170 2:73186131-73186153 TATTCACAATTCTGGGGGTCAGG + Intergenic
933823496 2:86137093-86137115 CACTCATTACTCTCTGGGTGAGG - Exonic
934247549 2:90321140-90321162 TAGTTAAATCTCTCTGGGTCAGG + Intergenic
934261774 2:91481461-91481483 TAGTTAAATCTCTCTGGGTCAGG - Intergenic
934304816 2:91812440-91812462 TAGTTAAATCTCTCTGGGTCAGG - Intergenic
934328441 2:92040310-92040332 TAGTTAAATCTCTCTGGGTCAGG + Intergenic
934466821 2:94270825-94270847 TAGTTAAATCTCTCTGGGTCAGG + Intergenic
934568520 2:95353734-95353756 TGGTCACAAAGCTCTGGGTCGGG - Intronic
940780203 2:157925206-157925228 TACTCCCACCTCCCTGGTTCAGG - Intronic
942099885 2:172569789-172569811 TAATCCCAACACTCTGGGGCAGG - Intronic
945090946 2:206175049-206175071 TTCTCACAATTCTGAGGGTCAGG - Intergenic
945914951 2:215693702-215693724 GACTCACAAATCTGTGGCTCTGG - Intergenic
946916216 2:224524877-224524899 TACTTACCACTTTCTGGGTAGGG - Intronic
948870489 2:240795517-240795539 AACTGGCAGCTCTCTGGGTCTGG + Intronic
1170052226 20:12158753-12158775 AACTCACATCTCTCCAGGTCAGG - Intergenic
1170357022 20:15504145-15504167 TAGTCAGACCTCTCTGGGTGTGG - Intronic
1170559236 20:17541812-17541834 CACTCACAGCTCTGTGGCTCTGG - Intronic
1170581592 20:17703532-17703554 TTCTTCCAATTCTCTGGGTCTGG + Intronic
1175190887 20:57211493-57211515 TACCCACAGCTTCCTGGGTCAGG - Intronic
1180269950 22:10574816-10574838 TAGTTAAATCTCTCTGGGTCAGG - Intergenic
1180587958 22:16910047-16910069 TAGTTAAATCTCTCTGGGTCAGG + Intergenic
1181582229 22:23834730-23834752 TCTTCTCAGCTCTCTGGGTCTGG - Exonic
1181853600 22:25767303-25767325 CAGTCACAAATGTCTGGGTCAGG + Intronic
949522931 3:4873086-4873108 TTCTCATGATTCTCTGGGTCAGG - Intronic
951195094 3:19814752-19814774 TATTCACAATTCTGTGGGTCAGG - Intergenic
951447439 3:22798971-22798993 CACTTCCAACTCTCTGTGTCTGG - Intergenic
951605016 3:24423218-24423240 TTCTTACAATTCTATGGGTCAGG - Intronic
951951870 3:28207946-28207968 AATTCACAATTTTCTGGGTCAGG + Intergenic
952599053 3:35056626-35056648 TTCTCACAAGTCTGTGGGTTGGG + Intergenic
953007189 3:38989360-38989382 TACTCACAGATCTGTGGGTTAGG - Intergenic
953181796 3:40602568-40602590 TGCTCACAATTCTGTGAGTCAGG + Intergenic
954455909 3:50599770-50599792 CACTGACAACTGTCTGGGACTGG - Intergenic
955962423 3:64354613-64354635 TGCTCACAACTCTGTGAGTTAGG + Intronic
957553750 3:81739386-81739408 TACACTCAAATTTCTGGGTCTGG - Intronic
959614256 3:108329619-108329641 AATTCACAACTGACTGGGTCCGG + Intronic
960675714 3:120192932-120192954 TACTCACCACTCTCTTGTCCGGG + Exonic
961478841 3:127166561-127166583 TGCTCACAATTTTGTGGGTCAGG + Intergenic
962035336 3:131645491-131645513 TTCTTACAACTCTATGGGACAGG + Intronic
962749495 3:138423437-138423459 TACTCATGTCTCTCTGGGGCTGG - Intergenic
963280121 3:143376139-143376161 TACTCACAGCTTACTGGGTTTGG + Intronic
963779524 3:149473442-149473464 TACTTAGAAATCTCAGGGTCAGG - Intergenic
964256008 3:154774856-154774878 TCCTCACAACTCTATGAGGCAGG + Intergenic
964380098 3:156089989-156090011 TCCTCACAACACTCTGGGGCAGG + Intronic
967175317 3:186857548-186857570 TACCCTAAACTCTCTGGGGCAGG + Exonic
968390532 4:188662-188684 TCCACACAACTCTGTGTGTCAGG + Intergenic
969198749 4:5584873-5584895 TACTCACTGCTCTCTGGGTTTGG - Intronic
970248592 4:14090703-14090725 TGCTCACAATTTTGTGGGTCAGG + Intergenic
973797849 4:54447154-54447176 TACTCACAACTTTCTGAGGAAGG + Intergenic
973828513 4:54734373-54734395 AACTCATAACTTTCTGAGTCAGG - Intronic
975952165 4:79787422-79787444 GACACAAATCTCTCTGGGTCTGG + Intergenic
982005982 4:151063248-151063270 TTCTCACAAGTCTGTGGGTCAGG + Intergenic
982291790 4:153789173-153789195 TGGTCACTACTTTCTGGGTCTGG + Intergenic
985617360 5:931594-931616 TGCTGAAATCTCTCTGGGTCTGG + Intergenic
985826340 5:2194311-2194333 TACCCAGAACTATCTAGGTCTGG + Intergenic
986641852 5:9879691-9879713 TCATCACATCTCTATGGGTCAGG - Intergenic
986796228 5:11214974-11214996 CACTGACATCTCTCTGGGTGAGG - Intronic
986854625 5:11854155-11854177 TGCTCACTGCTCTCTGGGCCTGG + Intronic
989993654 5:50800718-50800740 CACTAACAACTATCTGGGCCTGG + Intronic
992202781 5:74400485-74400507 TATTAAGAATTCTCTGGGTCAGG + Intergenic
992397475 5:76381185-76381207 TGCCCACACCTCTGTGGGTCTGG - Intergenic
994956622 5:106541310-106541332 TACTCACTCCTCTCTATGTCTGG + Intergenic
997744416 5:136286647-136286669 TACTCACAATTCTGTAGGTCAGG - Intronic
997815425 5:137012473-137012495 TTCTCACAACTCTTTGAGGCAGG + Intronic
1001299810 5:170525352-170525374 TCCACACAACTCTATGGGGCAGG - Intronic
1001349521 5:170945477-170945499 TTGTCACAACTCTATGGGCCAGG + Intronic
1004660517 6:17706036-17706058 TTCCCCCAACTCTCTGGGTCAGG - Intronic
1005851831 6:29828382-29828404 TACTCCCGAGTCTCCGGGTCTGG + Intronic
1005961996 6:30700614-30700636 TGATCACAACTCTCTGAGGCTGG + Exonic
1007092817 6:39194596-39194618 GACTCACACCTCTCTTGGTAAGG + Exonic
1007375692 6:41455134-41455156 TTCTGACAACTCTGTGGGGCGGG + Intergenic
1007916456 6:45566036-45566058 TGCTCACAATTCTGTGGATCAGG + Intronic
1008756746 6:54804740-54804762 AACTCTCAATTCTCTGGCTCTGG - Intergenic
1010753729 6:79643307-79643329 TTCTCACCAGTCTCTTGGTCAGG - Intronic
1010785648 6:79997226-79997248 TACTTACAACATTCTGGGCCAGG + Intergenic
1011621368 6:89245987-89246009 TTCTCACAACTCTGTGAGTTAGG + Intergenic
1011809780 6:91117719-91117741 TACTCACAACTTCCTGAGTTGGG + Intergenic
1014771721 6:125465148-125465170 TTCTCACAAATCTCTAGGGCAGG - Intergenic
1016163734 6:140913496-140913518 TGCTCACAATTTTCTGGGTCAGG + Intergenic
1016363627 6:143293064-143293086 TCCTCACAACTCTGTGAGGCAGG - Intronic
1023356677 7:39374435-39374457 TACTGACAGCTTTCTGGGTCTGG + Intronic
1025101296 7:56137239-56137261 CTTTCACAACTCCCTGGGTCAGG + Intergenic
1028117798 7:87021015-87021037 TCCTCACAACTCTATGGGGTAGG + Intronic
1028703656 7:93813168-93813190 TGCTCACAATTCTGTGGGGCAGG - Intronic
1028811613 7:95094445-95094467 TAATCACATCACTGTGGGTCAGG - Intronic
1030147742 7:106373364-106373386 TGCTCACAATTGTGTGGGTCAGG - Intergenic
1030529987 7:110700134-110700156 ATCTCACAATTCTGTGGGTCAGG - Intronic
1032086946 7:128889354-128889376 TACTCCCAGCTCTCCGGGTTGGG - Intronic
1033843978 7:145410008-145410030 TACTCCCAACTCTCTACTTCAGG - Intergenic
1037857211 8:22380471-22380493 GAATCACAACTTTCTGGGTGAGG - Intronic
1037946893 8:22995329-22995351 TACTGAGAACTCCCTGGGACCGG - Intronic
1038526481 8:28278525-28278547 TACTCAAAACTGTCAAGGTCAGG + Intergenic
1042825566 8:72975886-72975908 TGCTCACAAATCTGTAGGTCAGG - Intergenic
1042972621 8:74427338-74427360 TTATCACAATTCTATGGGTCAGG - Intronic
1049140514 8:140949966-140949988 TGCTAACATCTCTCTGAGTCTGG - Intronic
1050808919 9:9719162-9719184 TCCTCACAAGTCTCTGGATCTGG - Intronic
1051342597 9:16125732-16125754 TACTCACATCTATCTGGGAATGG + Intergenic
1051501201 9:17779539-17779561 TCTTCACAACTCTGTGGGTTTGG - Intronic
1051768837 9:20553940-20553962 AAATCACAAATCTCTGAGTCAGG + Intronic
1052778697 9:32758566-32758588 TGCTCACAATTCTATGGGCCAGG + Intergenic
1053010784 9:34631742-34631764 TTCTCACAATTCTGTGGGTCTGG + Intergenic
1053696870 9:40647625-40647647 TAGTTAAATCTCTCTGGGTCAGG + Intergenic
1053943265 9:43277758-43277780 TAGTTAAATCTCTCTGGGTCAGG + Intergenic
1054308122 9:63446858-63446880 TAGTTAAATCTCTCTGGGTCAGG + Intergenic
1054406856 9:64770849-64770871 TAGTTAAATCTCTCTGGGTCAGG + Intergenic
1054440480 9:65256315-65256337 TAGTTAAATCTCTCTGGGTCAGG + Intergenic
1054489927 9:65765609-65765631 TAGTTAAATCTCTCTGGGTCAGG - Intergenic
1056231481 9:84549724-84549746 TACTCACAATTTTCTGTGCCAGG - Intergenic
1060278074 9:122197388-122197410 TAATCACAACTCCCAGGATCTGG + Intronic
1060702590 9:125771031-125771053 TTCTCATTAGTCTCTGGGTCAGG + Intronic
1060833237 9:126733235-126733257 TACTGACAATTCTCTGGGAATGG - Intergenic
1202779323 9_KI270717v1_random:21284-21306 TAGTTAAATCTCTCTGGGTCAGG + Intergenic
1203586385 Un_KI270747v1:7663-7685 TAGTTAAATCTCTCTGGGTCAGG + Intergenic
1203617077 Un_KI270749v1:75534-75556 TAGTTAAATCTCTCTGGGTCAGG - Intergenic
1186473539 X:9839349-9839371 CACCCACATCTCCCTGGGTCTGG + Intronic
1186855451 X:13621704-13621726 CACTCACAGCTCTCTGTGTGAGG - Intronic
1189366115 X:40390022-40390044 TTCTCACAATTCCCTGGGTCAGG - Intergenic
1193080495 X:77401604-77401626 GCCTCACAACTCTCTGGTTTAGG - Intergenic
1193274677 X:79571209-79571231 TACTCACCACTTCCTGGGTCAGG + Intergenic
1196120181 X:112041624-112041646 TACTGACAACTCTGGGGGTAAGG + Intronic
1199373957 X:147085088-147085110 TCCTCACAACTTTGAGGGTCTGG - Intergenic
1201194597 Y:11479565-11479587 TAGTTAAATCTCTCTGGGTCAGG + Intergenic
1201562950 Y:15337021-15337043 CACTCACAAGTCTCAGGGCCTGG + Intergenic
1201946119 Y:19512267-19512289 TGCTCACAATTCACTGGGTCAGG - Intergenic
1202113490 Y:21448710-21448732 TACTCTCATCTGTCTGGGGCTGG - Intergenic