ID: 1081224582

View in Genome Browser
Species Human (GRCh38)
Location 11:40504443-40504465
Sequence GAATATGAACAGATGCCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 147}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081224579_1081224582 11 Left 1081224579 11:40504409-40504431 CCTCAGTTCCCACAGAAAAAGAC 0: 1
1: 1
2: 1
3: 35
4: 564
Right 1081224582 11:40504443-40504465 GAATATGAACAGATGCCACTTGG 0: 1
1: 0
2: 0
3: 16
4: 147
1081224580_1081224582 3 Left 1081224580 11:40504417-40504439 CCCACAGAAAAAGACTCAGATGA 0: 1
1: 0
2: 0
3: 25
4: 318
Right 1081224582 11:40504443-40504465 GAATATGAACAGATGCCACTTGG 0: 1
1: 0
2: 0
3: 16
4: 147
1081224581_1081224582 2 Left 1081224581 11:40504418-40504440 CCACAGAAAAAGACTCAGATGAA 0: 1
1: 0
2: 0
3: 35
4: 475
Right 1081224582 11:40504443-40504465 GAATATGAACAGATGCCACTTGG 0: 1
1: 0
2: 0
3: 16
4: 147
1081224578_1081224582 15 Left 1081224578 11:40504405-40504427 CCATCCTCAGTTCCCACAGAAAA 0: 1
1: 0
2: 3
3: 29
4: 388
Right 1081224582 11:40504443-40504465 GAATATGAACAGATGCCACTTGG 0: 1
1: 0
2: 0
3: 16
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081224582 Original CRISPR GAATATGAACAGATGCCACT TGG Intronic
900378958 1:2374183-2374205 GAAATTGGACAGAGGCCACTTGG + Intronic
904132210 1:28283282-28283304 GAAAATGAACAGATACCTCAAGG - Intergenic
909807157 1:79885561-79885583 TAAAATGAAAAGATGCCACATGG - Intergenic
911077490 1:93891677-93891699 CAATATGGAAAGATTCCACTGGG + Intronic
913495755 1:119426748-119426770 GATTATGAACATATTCCACAAGG + Intergenic
917450061 1:175140529-175140551 GCAAATGAACTGATGCCAATGGG + Intronic
918008579 1:180564961-180564983 AAACAAGAACTGATGCCACTGGG - Intergenic
918306528 1:183251671-183251693 GTAAATGAACAGATGCCACCAGG + Exonic
918790190 1:188814927-188814949 TAACATTAACAGATGGCACTTGG - Intergenic
921612963 1:217233851-217233873 GATGATTAACAGTTGCCACTTGG - Intergenic
921729205 1:218558026-218558048 CAATATGAAATGATGCCAATTGG - Intergenic
924882467 1:248176731-248176753 GAATATATACAGATACCTCTTGG + Intergenic
1068463259 10:57354288-57354310 GACTCTGAAAAGAAGCCACTGGG - Intergenic
1068563355 10:58542923-58542945 GAATGTAAAGTGATGCCACTAGG + Intronic
1069151175 10:64962196-64962218 GAAAATGAATAGTTGCCAGTTGG - Intergenic
1074359923 10:112817514-112817536 GAATATGAACAGATAACCCTTGG + Exonic
1075925784 10:126251116-126251138 GAACATGACCAGATGACACAAGG + Intronic
1077278377 11:1729029-1729051 GTCTATAAAAAGATGCCACTAGG + Intergenic
1078281685 11:9908664-9908686 GATTATGAACAGATGGCATTTGG - Intronic
1078449412 11:11429157-11429179 GAACCTGAGCAGAAGCCACTGGG - Intronic
1080573822 11:33580271-33580293 TTATCTGAAAAGATGCCACTTGG + Intronic
1081224582 11:40504443-40504465 GAATATGAACAGATGCCACTTGG + Intronic
1084178894 11:67437048-67437070 GAAGATGAGCAGTTGCCTCTGGG - Intronic
1084737635 11:71116018-71116040 GAAAAAGATGAGATGCCACTTGG - Intronic
1087799338 11:102487178-102487200 GAAGATGAGAAGATTCCACTAGG + Intronic
1089057606 11:115599212-115599234 GAAGATGAATAGGTGCTACTAGG + Intergenic
1089222961 11:116890434-116890456 GAATGTAAACAAATGCCACTGGG + Intronic
1089377616 11:118005713-118005735 GAATTTGACCAGATGACAGTGGG - Intergenic
1098054840 12:66493964-66493986 GAATCTGTAAAGATGCCTCTGGG + Intronic
1099535500 12:83838762-83838784 GATGATGAACAAATGCCACATGG - Intergenic
1105400052 13:20083549-20083571 GAATAGGACCAGGTGCCCCTTGG - Intronic
1107353373 13:39539592-39539614 GAATAAACACAGGTGCCACTGGG + Intronic
1110530522 13:76592200-76592222 GATAAGCAACAGATGCCACTGGG + Intergenic
1112716003 13:102186392-102186414 CAATATTAATATATGCCACTAGG + Intronic
1113208073 13:107941229-107941251 GCATGTGATCAGATGCCCCTTGG - Intergenic
1119149247 14:72343181-72343203 GAATCTGAAAAGATCTCACTGGG + Intronic
1119664576 14:76475624-76475646 GAATTTGAACAGACGCCTGTAGG - Intronic
1119922888 14:78462800-78462822 GAATAAAAACAGATGCCCCTAGG - Intronic
1120062462 14:80000129-80000151 GAATAAGAACAGCAGCCACAAGG - Intergenic
1123993489 15:25702090-25702112 GCATTTGACCAGGTGCCACTGGG - Exonic
1132084395 15:98895114-98895136 GAGTATGAACAGGTGGCATTAGG + Intronic
1133130596 16:3674070-3674092 AAAAAAGAACAGATGCCTCTGGG - Intronic
1134648818 16:15892123-15892145 GAATAGGAAGAGATTCCTCTAGG - Intergenic
1137970904 16:52983926-52983948 TAGTATGAAAAGATCCCACTGGG + Intergenic
1139955019 16:70689039-70689061 GTTTATGAAAAGATGCCAATCGG + Intronic
1140265633 16:73418116-73418138 AAAGATGGACAGAGGCCACTGGG + Intergenic
1140744087 16:77965664-77965686 GATTATGAACAGACTCCGCTGGG + Intronic
1144409536 17:14987073-14987095 GAAGATGAACAGAAGACACCTGG + Intergenic
1145193120 17:20865158-20865180 GAATATGTATAAATACCACTAGG - Exonic
1145351385 17:22087351-22087373 GAATATGTATAAATACCACTAGG - Intergenic
1145403534 17:22567154-22567176 GAATATGTATAAATACCACTAGG - Intergenic
1145723384 17:27092681-27092703 GAATATGTATAAATACCACTAGG + Intergenic
1149930969 17:60754784-60754806 GAATATCAACAAATGTCAGTTGG - Intronic
1150549940 17:66200786-66200808 GGAAAGGAATAGATGCCACTAGG + Intergenic
1152684494 17:81687406-81687428 GAAGGTGAGTAGATGCCACTGGG + Intronic
1155688562 18:28586718-28586740 GAAAATGAAAAGATTACACTTGG - Intergenic
1158020205 18:52832783-52832805 CCATATGAACATGTGCCACTTGG - Intronic
1158884874 18:61817544-61817566 GAATATGAAAAGATGGCCCTCGG - Intronic
1163324877 19:16596929-16596951 GAATATGAACTGCTGCAAGTTGG - Intronic
1163778831 19:19234761-19234783 TAATGAGAGCAGATGCCACTGGG - Intronic
1166610815 19:44194245-44194267 GAATAATAATAAATGCCACTAGG - Intergenic
1167782751 19:51610813-51610835 CAATATGAGCAAATGCCCCTGGG + Intergenic
926505504 2:13709716-13709738 GAATATGAAGAGATGCCCTAAGG - Intergenic
927321357 2:21749599-21749621 GAAGATGACCAGAGGCCACTTGG - Intergenic
932406010 2:71513077-71513099 GAGAAGGAACAGGTGCCACTGGG + Intronic
935669209 2:105541128-105541150 AAATATTAACTGAGGCCACTTGG - Intergenic
939379598 2:141416917-141416939 GAATTTGGAAAGATTCCACTGGG + Intronic
939469641 2:142603959-142603981 GAATTTTGACAAATGCCACTTGG - Intergenic
943394940 2:187322471-187322493 GAATATGAGCATAAGCCATTTGG + Intergenic
944526564 2:200625806-200625828 GCACATGAACAGATTCCAATAGG + Intronic
944655280 2:201871295-201871317 GACTATAAACACATGCCACCAGG + Intronic
945384515 2:209180763-209180785 GAATATGAACTGATGTAAATTGG - Intergenic
946960045 2:224975409-224975431 GAATATTATCAGATTCCCCTGGG - Intronic
947075601 2:226341275-226341297 GATTATGAACAGCTCCCACAAGG + Intergenic
1169511470 20:6268748-6268770 TAATATAAACAGATGACATTTGG + Intergenic
1170404055 20:16017995-16018017 GAATACCACTAGATGCCACTAGG - Intronic
1170814629 20:19703097-19703119 GAATATTAAAGCATGCCACTAGG - Intronic
1171561687 20:26132634-26132656 GAATATGTATAAATACCACTAGG - Intergenic
1176649623 21:9532992-9533014 GAATATGTATAAATACCACTAGG + Intergenic
1177594875 21:23225600-23225622 GAATATGAACAGCTGTCAGTAGG + Intergenic
949239690 3:1855654-1855676 GAATTTTAACAGATGACAGTTGG + Intergenic
952179025 3:30898357-30898379 GAGTATAAAGATATGCCACTTGG + Intergenic
952987656 3:38800599-38800621 GAATAAGAATACCTGCCACTTGG - Intergenic
953766030 3:45743521-45743543 TAATATCAACAGGTGACACTTGG + Exonic
954180961 3:48881068-48881090 GCTTATGAACAGATGCCAAATGG + Intronic
956572991 3:70717887-70717909 CAAAATGAACACATGTCACTAGG - Intergenic
959187519 3:103065047-103065069 GAATGTGGACAGATGCTTCTAGG + Intergenic
960467646 3:118017006-118017028 GGAGATGAAGAGATGGCACTTGG + Intergenic
962851346 3:139310577-139310599 GAACATGAAAAGATGTCGCTGGG + Intronic
965090428 3:164155508-164155530 GAAGCTGAGCAGATGCCACTAGG - Intergenic
967685850 3:192415263-192415285 GAAAAGGAAAAGGTGCCACTGGG - Intronic
969381425 4:6801386-6801408 GAGACTGAAAAGATGCCACTAGG + Intronic
969888835 4:10240787-10240809 GAATGTGAAGAGATTCAACTGGG - Intergenic
969978487 4:11129482-11129504 GAATGTGAACATATTCCACTAGG - Intergenic
970302874 4:14700161-14700183 AAATATCAACACAAGCCACTGGG - Intergenic
970841576 4:20477606-20477628 GAATTTGAACAGAAGCCAAAGGG + Intronic
971403747 4:26301248-26301270 GAATTTAAACAGAGGCCACGTGG - Intronic
973978541 4:56286575-56286597 GAATTGGAAAAGATGCAACTTGG + Intronic
974657743 4:64846882-64846904 CAATATGAAGAAATTCCACTGGG - Intergenic
975838112 4:78445553-78445575 GAATAGGAAATGATGCCTCTAGG - Exonic
982025681 4:151252005-151252027 CAATGGGCACAGATGCCACTTGG - Intronic
983307810 4:166015768-166015790 GAATGTCAACAGAATCCACTGGG - Intronic
984237073 4:177172452-177172474 GAATATGAACAACAGACACTTGG - Intergenic
986381475 5:7190618-7190640 TAAGATGATCAGATGCCAGTAGG + Intergenic
986431736 5:7688024-7688046 GTAGATGAACAGATGCTACTGGG + Intronic
988277564 5:29101478-29101500 GAAAATATACAGATGACACTTGG + Intergenic
989455458 5:41638357-41638379 GAAAATGATCATCTGCCACTTGG - Intergenic
990193602 5:53288980-53289002 GAAAATGAACACAAGCCAGTGGG - Intergenic
991685418 5:69177678-69177700 TAATATGTACAGATGGCACATGG - Exonic
993130080 5:83885727-83885749 GAATTTGAACAAATCCCACATGG - Intergenic
994044998 5:95297557-95297579 TACTAAGAAAAGATGCCACTAGG + Intergenic
998923410 5:147096103-147096125 GAATAAGATGAGAAGCCACTGGG + Intergenic
999438542 5:151583040-151583062 GAAGATGAACAGCTGCCTCTGGG - Intergenic
1002689261 5:181038841-181038863 TAATGTGAACAGATGTCCCTAGG - Intergenic
1004037673 6:11939462-11939484 GAATATGTACACCTGGCACTAGG - Intergenic
1004065544 6:12240383-12240405 AAATATTATCAGATCCCACTGGG - Intergenic
1004764724 6:18713316-18713338 CAAAATGAAAAGATGGCACTAGG - Intergenic
1005199563 6:23327817-23327839 AAATATGAACAAATGCCAGTTGG + Intergenic
1005301370 6:24474478-24474500 GGATATGAATACCTGCCACTTGG - Intronic
1007239652 6:40415847-40415869 GAATCTGAACAAATAGCACTGGG + Intronic
1009473408 6:64056796-64056818 GTAGATCAGCAGATGCCACTGGG + Intronic
1009894375 6:69728841-69728863 GAATCTGGAAAGGTGCCACTAGG + Intronic
1012049012 6:94315718-94315740 GAATATGAAAAGCCTCCACTCGG - Intergenic
1013345434 6:109255697-109255719 GAATTTAAGCATATGCCACTGGG + Intergenic
1015265258 6:131285304-131285326 AAATATGAATATGTGCCACTGGG - Intergenic
1015686033 6:135861884-135861906 GAAATTGAAGAGATGCCAGTTGG - Intronic
1017296861 6:152807587-152807609 GAATATGAAAAGATGCAGATGGG + Intergenic
1024202747 7:47122908-47122930 GAATGGGAACGGATGCCTCTTGG - Intergenic
1024283562 7:47738427-47738449 GAATTTGCACAAATGCCACCTGG - Intronic
1025276192 7:57583070-57583092 GAATATGTATAAATACCACTAGG + Intergenic
1031115481 7:117663259-117663281 GAATATGAATAAAGGGCACTGGG - Intronic
1032638913 7:133743095-133743117 TGATAAGAACAGATGCCGCTGGG - Intronic
1036289127 8:7471827-7471849 GAAAAGGAACAGATGCAACAGGG - Intronic
1036332348 8:7839700-7839722 GAAAAGGAACAGATGCAACAGGG + Intronic
1037414418 8:18633913-18633935 AAAAATTAACAGATGCCAGTGGG - Intronic
1038903637 8:31872473-31872495 GAAAACTAACAGATGCCACCAGG - Intronic
1040547322 8:48408880-48408902 GAAGATGAGCAGATGCTGCTGGG + Intergenic
1042813799 8:72855522-72855544 GAATATGGAGAGATGATACTGGG - Intronic
1043808244 8:84701261-84701283 GTATATGAACTCATGCAACTTGG - Intronic
1044024050 8:87146124-87146146 TAAAATGAACAGAGGACACTGGG - Intronic
1044371293 8:91414294-91414316 GAATTTGAAGAGATGCCAAATGG - Intergenic
1048236446 8:132695465-132695487 GAGTAGGAACAGATGCCCGTAGG + Intronic
1050920425 9:11195029-11195051 AATAATGAACAGATGCCAATAGG + Intergenic
1052450686 9:28626724-28626746 GAAGCTGAATAAATGCCACTAGG - Intronic
1052592946 9:30522077-30522099 GAAAAAGAACATATTCCACTTGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053597861 9:39581963-39581985 GACTGTGAACAGATGCCAATGGG - Intergenic
1053855882 9:42338967-42338989 GACTGTGATCAGATGCCAGTGGG - Intergenic
1056240202 9:84637883-84637905 GAATATAAACAGATATGACTTGG + Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058137297 9:101320973-101320995 GAATATGAAAACATGCTACAGGG + Intronic
1060215337 9:121735594-121735616 AAATATGAACAGAAGCCAGTGGG - Intronic
1062331028 9:136045034-136045056 GACCCTGGACAGATGCCACTGGG - Intronic
1203627364 Un_KI270750v1:36540-36562 GAATATGTATAAATACCACTAGG + Intergenic
1186706716 X:12147286-12147308 GAATATGGACAGAAGTCACAGGG + Intronic
1186989663 X:15053801-15053823 AAATATTAACCCATGCCACTTGG - Intergenic
1193624493 X:83800292-83800314 GAATATGAACAGCTAGCACCAGG + Intergenic
1195120302 X:101743423-101743445 GAATATGAAATTATGCCACTTGG - Intergenic
1196343113 X:114620073-114620095 CAATATTTACAGCTGCCACTTGG - Intronic
1197326525 X:125101301-125101323 AGATATGAATAGATGCCTCTTGG - Intergenic
1201339218 Y:12914511-12914533 GAATATTAACAGATGACAAAGGG - Intronic