ID: 1081225477

View in Genome Browser
Species Human (GRCh38)
Location 11:40516958-40516980
Sequence CTTATATAGGCCAGAATGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081225472_1081225477 18 Left 1081225472 11:40516917-40516939 CCTACACTGCACAGAGCATTGTA 0: 1
1: 0
2: 2
3: 18
4: 199
Right 1081225477 11:40516958-40516980 CTTATATAGGCCAGAATGAAAGG 0: 1
1: 0
2: 0
3: 16
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081225477 Original CRISPR CTTATATAGGCCAGAATGAA AGG Intronic
905067158 1:35193168-35193190 CTTATATAGGCCAGCTGGCACGG + Intergenic
913415554 1:118602774-118602796 CTTATATGAGCCAAAATGGAGGG - Intergenic
916360094 1:163958694-163958716 CTTGTAAAGGCCAGAAGAAAGGG - Intergenic
916469239 1:165107117-165107139 CACACATAGGCCAGAATAAAGGG - Intergenic
917602049 1:176585319-176585341 AATGTATAGGCCAGAAAGAATGG - Intronic
921449480 1:215288093-215288115 TCTGTATAGGACAGAATGAAAGG + Intergenic
921577809 1:216857742-216857764 CTTATATTGCTAAGAATGAAGGG - Intronic
921662392 1:217820323-217820345 TTTAGAGAGGCCAGAATGAATGG + Intronic
1065070404 10:22018086-22018108 CATATATAGGCAAGAGAGAAAGG + Intergenic
1069222597 10:65903349-65903371 TTTTTATAGGCCAGGATGGAGGG - Intergenic
1069257482 10:66352019-66352041 GTACTATATGCCAGAATGAAAGG + Intronic
1071867135 10:89746984-89747006 TTTATGTAGGTCACAATGAATGG + Intronic
1078939016 11:15979633-15979655 AATAAATAGGCCAGAATGACAGG - Intronic
1079483692 11:20911419-20911441 CTTATATAGCCCAGAAGTGATGG + Intronic
1081079165 11:38718225-38718247 CTTATATAGGCCAGACACAGAGG + Intergenic
1081225477 11:40516958-40516980 CTTATATAGGCCAGAATGAAAGG + Intronic
1082143380 11:48635629-48635651 AATATTTAAGCCAGAATGAATGG - Intergenic
1082143898 11:48643890-48643912 AATATTTAAGCCAGAATGAAGGG - Intergenic
1082567911 11:54702285-54702307 AATATTTAAGCCAGAATGAAGGG - Intergenic
1082570564 11:54732903-54732925 GATATTTAAGCCAGAATGAATGG - Intergenic
1082571060 11:54741012-54741034 AATATTTAAGCCAGAATGAAAGG - Intergenic
1082612215 11:55313991-55314013 AATATTTAAGCCAGAATGAAGGG - Intergenic
1082621320 11:55425720-55425742 AATATTTAAGCCAGAATGAAGGG - Intergenic
1085997317 11:81934968-81934990 ATTATATAAGACAGCATGAATGG + Intergenic
1087021684 11:93609598-93609620 ATTCTATAGGCCTGAGTGAAAGG + Intergenic
1087302170 11:96448336-96448358 CGTATATAGGACAGACTGCAGGG - Intronic
1088164185 11:106912415-106912437 CTTATATAGGACAGAGGAAAAGG - Intronic
1088384737 11:109241102-109241124 CTTATATAGACATGAATGAATGG - Intergenic
1088475061 11:110227657-110227679 CCTATATAGGCCAAAACAAAGGG + Intronic
1090762388 11:129848877-129848899 CTTATAAAGGGCTGAATGGAGGG - Intronic
1091899331 12:4132406-4132428 CTTAAAAAGTCCAGAATGAAAGG + Intergenic
1093257459 12:16887412-16887434 CTTATGAAGGCTAGAATGAAAGG - Intergenic
1095637279 12:44449228-44449250 CTTATATAAGCCAGAAGGAGGGG + Intergenic
1096610058 12:52795295-52795317 CTTGGATAGGCCAGACTGGAGGG - Intronic
1098540938 12:71656666-71656688 ATTATAGAGGCCAGAATGTCAGG + Intronic
1101480388 12:105090787-105090809 CTTTAATAGGCAAGAAAGAAGGG - Intergenic
1102777093 12:115529578-115529600 CTTATGTAGGTCACAATGGATGG + Intergenic
1105812836 13:24009857-24009879 GTTATTTAGGCCAGGATGGAAGG - Intronic
1111470054 13:88669384-88669406 CTAATATACGCCAGAAGAAATGG + Intergenic
1115070666 14:29318382-29318404 CTTATAGAGGTCAGAGTCAATGG + Intergenic
1115437518 14:33392250-33392272 CAAATATAAGCCAGAAGGAAAGG + Intronic
1121195359 14:92067113-92067135 ATCATAAAGGCCAGAAGGAAGGG - Intronic
1122500387 14:102194236-102194258 CTTATCGAGGCCATAATCAAAGG - Intronic
1123431951 15:20225493-20225515 CTTATATGGGCAAGAAGGAGAGG - Intergenic
1125108946 15:36007853-36007875 CTTATAAAGGCCTGCATGCAAGG + Intergenic
1136852688 16:33625646-33625668 CTTATATGGGCAAGAAGGAGAGG + Intergenic
1140612185 16:76613398-76613420 ATTATATGGGCCAGAGTGAGGGG - Intronic
1141322041 16:83020327-83020349 ATTAAAGAGGCCAGAATGAGAGG - Intronic
1141720354 16:85752158-85752180 CTTATAGAGTCCAGACTGACAGG + Intergenic
1203114291 16_KI270728v1_random:1474114-1474136 CTTATATGGGCAAGAAGGAGAGG + Intergenic
1147538065 17:41333781-41333803 CATATAGAAGCCAGACTGAATGG + Intergenic
1149082581 17:52676948-52676970 CTGATCTAGGCCAGAAAGATGGG - Intergenic
1155466019 18:26136106-26136128 ATTATATGGGCCACAATTAAAGG + Intronic
1161024378 19:2028849-2028871 CAATTAAAGGCCAGAATGAAAGG + Intronic
1162839461 19:13345318-13345340 GTTGTAAAGGCCAGAATGACGGG - Intronic
1164969490 19:32519245-32519267 CTTCCAAAGGCCAGACTGAAGGG + Intergenic
1166961114 19:46496240-46496262 ATTATATAGGCCTAAATCAAAGG + Exonic
1167220222 19:48194527-48194549 CATATGCAGGCAAGAATGAATGG + Intronic
926643882 2:15267317-15267339 CTTATTCAGGCCAGAATCAAAGG + Intronic
926683181 2:15679423-15679445 CTCATATAGTCCATATTGAATGG + Intergenic
929003172 2:37368033-37368055 CTTATAAAGGCCTGAAAGAAGGG - Intronic
929629508 2:43445072-43445094 GTTTTATAGGCCAGAATCTAGGG - Intronic
937612914 2:123884459-123884481 TTTATAAATGCAAGAATGAATGG - Intergenic
937790878 2:125959990-125960012 TTTATATAAGACACAATGAAGGG - Intergenic
939721864 2:145663515-145663537 CTACTATTGGCCAAAATGAAAGG - Intergenic
940311902 2:152287979-152288001 CTAATATAGGCCACATTGACAGG - Intergenic
944270657 2:197782410-197782432 CTCATATCAGCCAGAATGGAGGG - Intronic
1169181461 20:3572393-3572415 GTGTTATAGGCCAGGATGAAAGG + Intronic
1172239409 20:33402419-33402441 CTGAGATGGGCCAGAATGACAGG - Intergenic
1173451347 20:43166863-43166885 CTCATATAGGGCAGAATTGATGG - Intronic
1174376768 20:50131238-50131260 CTTATATGGGGCAGAGAGAAGGG - Intronic
1174907263 20:54564567-54564589 GTTTTATATGCCAGAATGACAGG + Intronic
1177217166 21:18145550-18145572 CTTATATAGCATAGAATGGAGGG + Intronic
1178063385 21:28876230-28876252 ATTCTATAGGCCTGACTGAAAGG + Exonic
1179138895 21:38705397-38705419 CTTATTCAAGCCAGAAAGAAGGG + Intergenic
1179381265 21:40901507-40901529 TTGATATAAGACAGAATGAAGGG + Intergenic
1181940624 22:26473077-26473099 ATTAACTTGGCCAGAATGAAGGG - Intronic
949591388 3:5497614-5497636 CTTATATATGTCAGAAAGTAGGG + Intergenic
952215688 3:31275924-31275946 CTTATAAAAGGCAGAAAGAAGGG + Intergenic
952569839 3:34701387-34701409 GATAAATTGGCCAGAATGAAAGG + Intergenic
957849774 3:85792274-85792296 CAAATATATGCCAAAATGAAGGG + Intronic
959175634 3:102905849-102905871 CTTGTATAAGTCAGAGTGAAGGG - Intergenic
959822877 3:110757162-110757184 GTTTAATAGGCCAGAAAGAAGGG - Intergenic
962649851 3:137477499-137477521 CTTCTAAAGGCCAGAATTAAAGG - Intergenic
962732492 3:138296253-138296275 CGTACATGGGCCAGAATGAATGG + Exonic
965504601 3:169499129-169499151 CATATATATACCAGAAGGAAAGG + Intronic
966813859 3:183872812-183872834 CTTATTTAAGGCAGAAAGAAGGG - Intronic
967950817 3:194838924-194838946 CTTATTCAAGCCAGAAAGAAAGG + Intergenic
970697341 4:18693877-18693899 ATTCTATATGTCAGAATGAAAGG - Intergenic
975510377 4:75188423-75188445 CTCATATATGGAAGAATGAAAGG - Intergenic
980256111 4:130382581-130382603 CAGAAATTGGCCAGAATGAAGGG - Intergenic
983466469 4:168099030-168099052 TTTAAATAAGCCAGAATGGAAGG + Intronic
989160290 5:38384510-38384532 CTTATATAAGCCAGAAGTACTGG + Intronic
990811575 5:59731062-59731084 CTTATATAAATAAGAATGAAAGG - Intronic
990938982 5:61181578-61181600 TTTATATTTGCCAGAATAAAGGG + Intergenic
991049194 5:62254507-62254529 CTTATATAGGCAAGAAGGAGAGG - Intergenic
991467821 5:66932999-66933021 CTTATTTAGGTGAGAATTAAAGG - Intronic
994619631 5:102147608-102147630 CTTAACTTGGCCATAATGAACGG - Intergenic
995908169 5:117151986-117152008 CATATATAGGCAAAACTGAAAGG - Intergenic
995949481 5:117692768-117692790 ATTATATAGGCCAGAATGTGAGG + Intergenic
996334587 5:122368929-122368951 TTTATATAGGACAAAATGGAAGG - Intronic
996507431 5:124283875-124283897 ATTTTATAGGCCAGAAACAAGGG - Intergenic
997199871 5:132003451-132003473 CTTTTCAAGGCCAGGATGAATGG + Intronic
998084405 5:139305592-139305614 CTTATAAATGCCAGACAGAATGG - Intronic
1000068142 5:157714332-157714354 CTTACATAGGTCAGGGTGAATGG - Intergenic
1001007604 5:168067617-168067639 CTTACTTAGGCAAGAAAGAAGGG - Intronic
1001772669 5:174307939-174307961 CTTAGAGAAGCCAGAATGATTGG - Intergenic
1009037879 6:58140064-58140086 CTGATATATGCCAGCATCAAGGG - Intergenic
1009213667 6:60893700-60893722 CTGATATATGCCAGCATCAAGGG - Intergenic
1009740501 6:67737430-67737452 CTTATCTAAGCCATAAGGAAAGG - Intergenic
1009950298 6:70387542-70387564 CTTATCTCGGCTAGAAAGAAGGG + Intergenic
1014671844 6:124314055-124314077 CTTATACAGGCCAGAATGGGAGG + Intronic
1014689242 6:124542217-124542239 TTTATTTAGCTCAGAATGAATGG - Intronic
1016342258 6:143075714-143075736 CTTATATAGGAAAGAATAAAGGG - Intronic
1018190862 6:161308094-161308116 CTTTAATAGGCAAGAAGGAAGGG + Intergenic
1023493224 7:40766751-40766773 CATATATAGGCCAGGAGGATAGG - Intronic
1025913838 7:65849951-65849973 CTTTTATAGGCCAGGATGGGAGG + Intergenic
1028271298 7:88793547-88793569 ATTATATAGGCCAGAATATGTGG + Intronic
1029303108 7:99599929-99599951 CGGATATAGGCCAGACTGAAAGG - Intronic
1031383174 7:121113344-121113366 CTAATACAGGGCAGAATGCAAGG + Intronic
1035002867 7:155629217-155629239 CTTAGAAAGCCAAGAATGAAAGG - Intronic
1039958834 8:42228908-42228930 CTTTTATAGGCCAAGATGCATGG - Intergenic
1040695837 8:49997257-49997279 CTTGAATAGGCCAGAGGGAATGG - Intronic
1040813495 8:51482288-51482310 CAGAAATTGGCCAGAATGAAGGG - Intronic
1043244778 8:77983920-77983942 ATTATATATGGCACAATGAATGG + Intergenic
1046390041 8:113559023-113559045 ATTATTTCGGCCAGAAAGAAGGG - Intergenic
1046574096 8:116003718-116003740 ATTATATAGGCCAGAAACATGGG + Intergenic
1049788869 8:144463930-144463952 CTTGTCTAGACCAGAATGAAAGG - Intronic
1050476877 9:6049533-6049555 GGTATATAGGTGAGAATGAATGG + Intergenic
1051866276 9:21686549-21686571 CTCATATAGGCCAGAGTAAAGGG + Intergenic
1054958642 9:70942359-70942381 CATATCTAGGCCAAAATGCATGG + Intronic
1056816484 9:89805256-89805278 ATTATCTAGGCCAGGATAAAAGG - Intergenic