ID: 1081226889

View in Genome Browser
Species Human (GRCh38)
Location 11:40534969-40534991
Sequence GGGTCTAAACATATGGTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 270}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081226885_1081226889 5 Left 1081226885 11:40534941-40534963 CCTAATGTCAGAGTGCTCTGTGC 0: 1
1: 0
2: 1
3: 5
4: 162
Right 1081226889 11:40534969-40534991 GGGTCTAAACATATGGTCCATGG 0: 1
1: 0
2: 0
3: 14
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081226889 Original CRISPR GGGTCTAAACATATGGTCCA TGG Intronic
901912274 1:12469199-12469221 GGGTCTCAAAATACGGTCTAGGG + Intronic
903970755 1:27117380-27117402 GAGTCTAAAGAGATAGTCCAGGG + Intronic
904901200 1:33858428-33858450 GAGGCTAAACATATGAGCCAAGG + Intronic
905353685 1:37365783-37365805 GGTTCTCCACATATGGTCAAAGG - Intergenic
906867684 1:49440509-49440531 GGTTCTCCACATATGGTCAAAGG - Intronic
906879300 1:49573485-49573507 GGTTCTCCACATATGGTCAAAGG - Intronic
908616643 1:65929706-65929728 GGTTCTGCACATATGGTCAAAGG + Intronic
909549347 1:76880142-76880164 GGTTCTCCACATATGGTCAAAGG + Intronic
910284038 1:85533361-85533383 GGGTCTCACTATATTGTCCAGGG + Intronic
910561466 1:88596680-88596702 GGTTCTCCACATATGGTCAAAGG - Intergenic
910587780 1:88898436-88898458 GGTTCTCCACATATGGTCAAAGG - Intergenic
911667335 1:100568418-100568440 GGTTCTCCACATATGGTCAAAGG - Intergenic
911680147 1:100705898-100705920 GGCTCTTAAAATATGGTCCAAGG - Intergenic
912071081 1:105810382-105810404 TGGTCTCCACATATGGTCAAAGG + Intergenic
912677174 1:111693831-111693853 GAGTCTCAAAATATGGTCCAAGG - Intronic
912944236 1:114071203-114071225 GGTTCTCCACATATGGTCAAAGG + Intergenic
913571320 1:120123029-120123051 TGGCCTAAATAAATGGTCCAGGG - Intergenic
914205981 1:145529624-145529646 GGGTCTCACTATATTGTCCAGGG - Intergenic
914292132 1:146284006-146284028 TGGCCTAAATAAATGGTCCAGGG - Intergenic
914553176 1:148734789-148734811 TGGCCTAAATAAATGGTCCAGGG - Intergenic
918774137 1:188607742-188607764 GGTTCTCCACATATGGTCAAAGG - Intergenic
919125037 1:193383094-193383116 GGCTCTCCACATATGGTCAAAGG + Intergenic
919241416 1:194921511-194921533 GGTTCTCCACATATGGTCAAAGG - Intergenic
919398866 1:197083483-197083505 GGTTCTCCACATATGGTCAAAGG - Intergenic
919816515 1:201444131-201444153 GGGTCACAACATTTAGTCCATGG - Intergenic
920197027 1:204235339-204235361 GGTTCTCCACATATGGTCAAAGG - Intronic
924600219 1:245482280-245482302 GGGTTTCACCATATTGTCCAAGG + Intronic
1064546050 10:16450805-16450827 GGTTCTCCACATATGGTCAAAGG + Intronic
1064796110 10:19013135-19013157 TGGGCTAAACATAAGATCCATGG - Intergenic
1065197087 10:23277022-23277044 AGATCTCAACATGTGGTCCAAGG + Intronic
1067126028 10:43516152-43516174 GGTTCTCCACATATGGTCAAAGG + Intergenic
1068006169 10:51394044-51394066 TTCTCTATACATATGGTCCAGGG - Intronic
1068837633 10:61571590-61571612 GGTTCTCCACATATGGTCAAAGG + Intergenic
1070710029 10:78674416-78674438 GGGTTTAAACACATTCTCCATGG + Intergenic
1071943179 10:90610773-90610795 GGTTCTCCACATATGGTCAAAGG + Intergenic
1072100103 10:92221298-92221320 GGGTTTCATCATATTGTCCAGGG - Intronic
1073556937 10:104462889-104462911 GGTTCTCCACATATGGTCAAAGG - Intergenic
1075606474 10:123815119-123815141 GGTTCTCCACATATGGTCAAAGG - Intronic
1080065326 11:28004727-28004749 GAGTCTAAACATGTTGTCAAAGG + Intergenic
1081226889 11:40534969-40534991 GGGTCTAAACATATGGTCCATGG + Intronic
1085429593 11:76436464-76436486 GGGTCTCACCATATTGCCCAGGG + Intergenic
1085685555 11:78619183-78619205 GGTTCTCCACATATGGTCAAAGG - Intergenic
1086961948 11:92986856-92986878 GGTTCTCCACATATGGTCAAAGG + Intergenic
1087373748 11:97318241-97318263 GGTTCTCCACATATGGTCAAAGG - Intergenic
1088122025 11:106380990-106381012 GGGTCTCAAAATGTGGTCCCAGG + Intergenic
1088407997 11:109501670-109501692 GGTTCTCCACATATGGTCAAAGG + Intergenic
1090198088 11:124834189-124834211 GGAACTAAAAATATGGACCAGGG + Intergenic
1093032329 12:14299502-14299524 GGTTCTCCACATATGGTCAAAGG + Intergenic
1093035862 12:14332026-14332048 GGTTCTCCACATATGGTCCATGG - Intergenic
1093049289 12:14487870-14487892 GGTTCTCCACATATGGTCCAAGG + Intronic
1093050038 12:14493970-14493992 GGTTCTCCACATATGGTCCAAGG + Intronic
1095939614 12:47717442-47717464 GGTTCTCAACATGTGGTCCCTGG - Intronic
1097110756 12:56656274-56656296 GGGTTTCAACATATTGCCCATGG + Intergenic
1098467303 12:70801956-70801978 GGGTAAAAACAGATGGTGCAGGG + Intronic
1098715663 12:73826428-73826450 GGTTCTCCACATATGGTCAAAGG - Intergenic
1098805061 12:75013060-75013082 GGTTCTCCACATATGGTCAAAGG - Intergenic
1099375255 12:81890956-81890978 GGTTCTCTACATATGGTCAAAGG - Intergenic
1099525999 12:83720163-83720185 GGTTCTTCACATATGGTCAAAGG - Intergenic
1099689735 12:85937712-85937734 GGCTCTTCACATATGGTCAACGG - Intergenic
1100049851 12:90435019-90435041 GGTTCTCCACATATGGTCAAAGG - Intergenic
1100082935 12:90875226-90875248 GGTTCTCCACATATGGTCAAAGG - Intergenic
1100684584 12:96973276-96973298 GGGTCCAAACAAAATGTCCATGG - Intergenic
1100886082 12:99071837-99071859 GGGTTTCAACATATTGGCCAGGG + Intronic
1101535076 12:105609122-105609144 GGTTCTCTACATATGGTCAAAGG + Intergenic
1103035153 12:117650702-117650724 GGGTCTCCAAATATGGTCAAAGG - Intronic
1103670752 12:122612942-122612964 GGTTCTTAACATGTGGTCCATGG - Intronic
1103745159 12:123117800-123117822 GGGGCTAAACATATGATTTAGGG - Intronic
1107864278 13:44688207-44688229 GGGTCTTAACTTGGGGTCCATGG - Intergenic
1109249122 13:59997153-59997175 GGGTGCAAACATATGGTAGAAGG - Intronic
1109292756 13:60496637-60496659 GGTTCTCCACATATGGTCAAAGG - Intronic
1109515909 13:63442316-63442338 GGTTCTCCACATATGGTCAAAGG - Intergenic
1109582666 13:64363120-64363142 GGTTCTCCACATATGGTCAAAGG - Intergenic
1111440398 13:88275442-88275464 AGTTTAAAACATATGGTCCATGG - Intergenic
1112315986 13:98362370-98362392 GGGTCTGAACGTCTGGTGCATGG - Intronic
1113871955 13:113565083-113565105 GGGTCTAAGAAGAGGGTCCAAGG - Intergenic
1116158777 14:41239685-41239707 GGTTCTCCACATATGGTCAAAGG + Intergenic
1116876318 14:50115672-50115694 GCGTATATACATATGGTCCCTGG + Intronic
1117597149 14:57334858-57334880 GGTTCTCCACATATGGTCAAAGG + Intergenic
1118573716 14:67220241-67220263 GGGTCTTGACATATTGCCCAGGG - Intronic
1120556394 14:85933440-85933462 GGTTCTCCACATATGGTCAAAGG + Intergenic
1120821394 14:88914887-88914909 GGGTTTAAAAATATGGGGCAGGG - Intergenic
1125927160 15:43572239-43572261 GGGTCTCAACATGTTGCCCAGGG - Intronic
1125940304 15:43671804-43671826 GGGTCTCAACATGTTGCCCAGGG - Intergenic
1126806353 15:52353164-52353186 GGCTCTCAAAATATGGTCCCTGG - Intronic
1129961794 15:79693075-79693097 GGTTCTCCACATATGGTCAAAGG + Intergenic
1133147760 16:3802809-3802831 GGGTCCAAACCTATGCTCCTCGG + Intronic
1135202741 16:20452917-20452939 GGTTCTCCACATATGGTCAAAGG - Intronic
1138747213 16:59377168-59377190 TGTTTTAAACATATTGTCCAGGG + Intergenic
1140597811 16:76436651-76436673 GGTTCTCCACATATGGTCAAAGG + Intronic
1142721033 17:1776042-1776064 GGCTCTTAACCTAAGGTCCATGG - Intronic
1144273631 17:13643875-13643897 GGTTCTAAAGGTATGGTCCCTGG + Intergenic
1144590194 17:16517249-16517271 GGTTCTCAACATGTGGTCCAAGG + Intergenic
1146460990 17:33045982-33046004 GGGTCTACTCATATGGACTAAGG + Intronic
1146850528 17:36217942-36217964 GGTTCTCCACATATGGTCAAAGG - Intronic
1150382736 17:64733502-64733524 GGGTCTCACTATATTGTCCAGGG - Intergenic
1151038013 17:70823228-70823250 GGCTCTCCACATATGGTCAAAGG + Intergenic
1151040433 17:70853770-70853792 GGGTCTAAACATGTCCTCAAAGG - Intergenic
1152936295 17:83139211-83139233 GGGTCTCACTATATGGCCCAGGG + Intergenic
1157107569 18:44788993-44789015 GGGTTTTAACATGTTGTCCAGGG + Intronic
1158869295 18:61668950-61668972 GTTTCTCAACATATAGTCCATGG + Intergenic
1159287399 18:66372448-66372470 GGTTCTCCACATATGGTCAAAGG - Intergenic
1159568086 18:70078907-70078929 GGGTCAAAAGATATGATGCATGG + Intronic
1159849990 18:73515927-73515949 GGTTCTCCACATATGGTCAAAGG - Intergenic
1168104186 19:54156610-54156632 GGTTCTCAGCATGTGGTCCAGGG - Intronic
1168624558 19:57907044-57907066 GGGTTTCACCATATTGTCCAGGG + Exonic
925460334 2:4057462-4057484 GGTTCTCCACATATGGTCAAAGG - Intergenic
925499792 2:4489928-4489950 GGTTCTCCACATATGGTCAAAGG + Intergenic
926534271 2:14091407-14091429 GGGTCTATCCATATGATTCAAGG - Intergenic
928100027 2:28431519-28431541 GGGGCTAAATAGCTGGTCCAAGG + Intergenic
929166892 2:38891572-38891594 GGGTCTTAACCTGTGGTCCCAGG - Intronic
929904788 2:46036382-46036404 GGGTCTCACTATATGGCCCAGGG - Intronic
932415292 2:71569961-71569983 GGGTCTAGACATTTGGTCTCTGG + Intronic
935183659 2:100712804-100712826 GGGTCTCCACATATGGCCGAAGG - Intergenic
935184962 2:100723658-100723680 TGCTCTACACATATGGTCCTGGG - Intergenic
935308026 2:101756757-101756779 GGGTCTCAACATGTTGTCCAGGG + Intronic
935564698 2:104593250-104593272 GGTTCTCCACATATGGTCAAAGG + Intergenic
937582116 2:123499616-123499638 GGTTCTCCACATATGGTCAAAGG + Intergenic
937630175 2:124092437-124092459 GGCTGTACACATATAGTCCATGG + Intronic
937785584 2:125890679-125890701 GGTTCTCCACATATGGTCAAAGG + Intergenic
937799942 2:126071730-126071752 GGTCCTCAACATATGGTCAAAGG - Intergenic
937802443 2:126096360-126096382 GGTTCTCCACATATGGTCAAAGG - Intergenic
939805855 2:146775460-146775482 GGTTCTCCACATATGGTCAAAGG - Intergenic
940002150 2:148976951-148976973 GGTTCTAAAGATCTTGTCCATGG - Intronic
940606307 2:155927374-155927396 GGTTCTCCACATATGGTCAAAGG + Intergenic
941002382 2:160215598-160215620 GGGTCTAAAAATAGGGTCCTTGG - Intronic
943509092 2:188802272-188802294 GGTTCTCCACATATGGTCAAAGG - Intergenic
945641782 2:212440808-212440830 GGTTCTCCACATATGGTCAAAGG - Intronic
1171137454 20:22709193-22709215 GGGTCCAGAAACATGGTCCAGGG - Intergenic
1172329958 20:34068608-34068630 ATGTTTAAACATATGGTACATGG - Intronic
1173517233 20:43673442-43673464 GGGTCTCACCATATTGCCCAGGG - Intronic
1173631201 20:44516984-44517006 TGGTCTTAAAATATGGTCCCAGG + Intronic
1173709528 20:45142246-45142268 GGTTCTCCACATATGGTCAAAGG + Intergenic
1175409612 20:58758068-58758090 GGTTCTCCACATATGGTCAAAGG + Intergenic
1176997766 21:15577213-15577235 GGTTCTCTACATATGGTCAAAGG - Intergenic
1178012247 21:28301898-28301920 GGTTCTCCACATATGGTCAAAGG - Intergenic
1178371143 21:32028596-32028618 GTTTCTCAAGATATGGTCCAGGG + Intronic
1180521340 22:16209162-16209184 GGGTTTCACCATATGGGCCAGGG - Intergenic
1182111671 22:27727974-27727996 GGGCCTAAACATGAGGTTCAGGG + Intergenic
949418052 3:3834214-3834236 GGTTCTCCACATATGGTCAAAGG + Intronic
950894254 3:16433874-16433896 GGCTCTAAAGATGTGCTCCAGGG + Exonic
951253383 3:20420108-20420130 GTGTCTGAACAAATGGTCAAAGG + Intergenic
953897784 3:46815519-46815541 GGCTCTCCACATATGGTCAAAGG + Intergenic
955035193 3:55261073-55261095 GGTTCTCCACATATGGTCAAAGG - Intergenic
955545566 3:60025228-60025250 GGGTCTACAGATAGGCTCCAGGG + Intronic
956853337 3:73252642-73252664 GGGTTTCACCATATTGTCCAGGG - Intergenic
957247925 3:77736351-77736373 GGTTCTCCACATATGGTCAAAGG + Intergenic
957945259 3:87055618-87055640 GGGTCTTATCATATTGCCCAAGG + Intergenic
962928807 3:140019005-140019027 GGGTCTAATCAGATGATCCTGGG + Intronic
963432744 3:145230370-145230392 GGTTCTCCACATATGGTCAAAGG + Intergenic
963661006 3:148129164-148129186 GGTTCTCCACATATGGTCAAAGG - Intergenic
964512361 3:157466838-157466860 GTGTAGAAACATATGGCCCAAGG + Intronic
965034924 3:163425506-163425528 GGTTCTCCACATATGGTCAAAGG + Intergenic
965050329 3:163638635-163638657 GGTTCTCCACATATGGTCAAAGG + Intergenic
965251868 3:166352668-166352690 GGTTCTCCACATATGGTCAAAGG + Intergenic
965996184 3:174885446-174885468 GGTTCTCCACATATGGTCAAAGG + Intronic
966044721 3:175533936-175533958 GGTTCTCCACATATGGTCAAAGG + Intronic
967505677 3:190250199-190250221 GGTTCTCCACATATGGTCAAAGG + Intergenic
967511217 3:190314917-190314939 GGATCAAAACACATGTTCCACGG + Intronic
967931798 3:194695407-194695429 GAGCCTAAACATCTGGTCAAAGG + Intergenic
968475276 4:802998-803020 GCGTCTGAACTTAGGGTCCAGGG + Intronic
968718227 4:2177805-2177827 GGGTGTAGACACATGGTACAAGG + Intronic
970272740 4:14364820-14364842 GGTTCTCAAAATATGGTCCCTGG + Intergenic
971268239 4:25113359-25113381 GGGTCAAAGAATATGCTCCATGG - Intergenic
972084844 4:35204014-35204036 GGTTCTCCACATATGGTCGAAGG - Intergenic
972192523 4:36612259-36612281 GGTTCTCCACATATGGTCAAAGG - Intergenic
973092617 4:46157303-46157325 GGTTCTCCACATATGGTCAAAGG - Intergenic
973199867 4:47488029-47488051 GGGTCTAAAAATATAGCCTAAGG + Intronic
974458775 4:62162216-62162238 GGTTCTCCACATATGGTCAAAGG - Intergenic
975126865 4:70792789-70792811 TGGTCTAAACATATGTTCTTTGG - Intronic
975734087 4:77364976-77364998 GGTTCTCCACATATGGTCAAAGG + Intronic
975983009 4:80180286-80180308 GGTTCTCCACATATGGTCAAAGG + Intergenic
977465604 4:97380387-97380409 GGTTCTCCACATATGGTCAAAGG - Intronic
977930775 4:102746525-102746547 GGTTCTCCACATATGGTCAAAGG + Intronic
978342234 4:107730632-107730654 GGTTCTCCACATATGGTCAAGGG + Intergenic
978772337 4:112469131-112469153 GGTTCTCCACATATGGTCAAAGG - Intergenic
978899476 4:113929847-113929869 GGTTCTCCACATATGGTCAAAGG + Intronic
978966458 4:114747910-114747932 GGTTCTCCACATATGGTCAAAGG - Intergenic
979018035 4:115459658-115459680 GGTTCTCTACATATGGTCAAAGG + Intergenic
979898918 4:126193047-126193069 GGTTCTCCACATATGGTCAAAGG + Intergenic
980698313 4:136389657-136389679 TGGGCTAAATATATAGTCCAAGG - Intergenic
981462404 4:145028780-145028802 GGTTCTCCACATATGGTCAAAGG - Intronic
982526815 4:156489397-156489419 GGTTCTCCACATATGGTCAAAGG - Intergenic
983581849 4:169317245-169317267 GGTTCTCCACATATGGTCAAAGG - Intergenic
986086724 5:4459698-4459720 GGTTCTTCACATATGGTCAAGGG - Intergenic
986742594 5:10717087-10717109 GGTTCTCCACATATGGTCAAAGG - Intronic
987245162 5:16041505-16041527 GGGTCTAATCATATGTTACCAGG - Intergenic
988056747 5:26106781-26106803 GGTTCTCAACATATGGTCAAAGG + Intergenic
988267873 5:28974390-28974412 GGTTCTCCACATATGGTCAAAGG + Intergenic
988561727 5:32287852-32287874 GGTTCTCCACATATGGTCAAAGG - Intronic
989097386 5:37793979-37794001 GGTTCTACACATATGGTCAAAGG - Intergenic
989383334 5:40830687-40830709 GGGTCTCACCATGTGGGCCAGGG + Exonic
989458034 5:41664786-41664808 GGTTCTCCACATATGGTCAAAGG + Intergenic
990397897 5:55403003-55403025 GGGTCTCATCATCTTGTCCAGGG - Intronic
991116479 5:62961498-62961520 GGCTCTCCACATATGGTCTAAGG + Intergenic
994006807 5:94846899-94846921 GGTTCTCAAAATATGTTCCATGG + Intronic
994836749 5:104865131-104865153 GGTTCTCCACATATGGTCAAAGG - Intergenic
995279467 5:110316922-110316944 GGTTCTCCACATATGGTCAACGG + Intronic
996825163 5:127674737-127674759 GGTTCTCCACATATGGTCAAAGG - Intergenic
997121685 5:131179965-131179987 GGGTCTCACCATATCGCCCAGGG + Intronic
997316749 5:132942897-132942919 GGGTCTCATCATGTGGCCCAAGG - Intronic
997465609 5:134085998-134086020 GGGTTTCACCATATTGTCCAGGG - Intergenic
1000416594 5:160990914-160990936 GGTTCTCCACATATGGTCAAAGG - Intergenic
1001620438 5:173079767-173079789 GGGTCTCAAAGTATGATCCAAGG - Intronic
1003315214 6:5005322-5005344 GGGTCTTACTATATTGTCCAGGG - Intergenic
1003696291 6:8409117-8409139 GGTTCTCCACATATGGTCAAAGG + Intergenic
1004312065 6:14554644-14554666 GGGTCTCATCATATTGGCCAGGG + Intergenic
1005135089 6:22559206-22559228 GGGCATAAACATTCGGTCCATGG - Intergenic
1005622861 6:27636039-27636061 GGTTCTCCACATATGGTCAAAGG + Intergenic
1007604756 6:43109361-43109383 GGGTCTCATCAAAAGGTCCAGGG - Intronic
1011115402 6:83885383-83885405 GAGTCTCAAAATATGGTCTAGGG - Intronic
1011939204 6:92821754-92821776 GGGTTTCACCATGTGGTCCAGGG - Intergenic
1012344192 6:98167313-98167335 GGTTCTCCACATATGGTCAAAGG - Intergenic
1012730091 6:102871323-102871345 GGTTCTCCACATATGGTCGAAGG - Intergenic
1014416624 6:121192374-121192396 GGTTCTCCACATATGGTCAAAGG - Intronic
1014456228 6:121637629-121637651 GGTTCTCCACATATGGTCAAAGG + Intergenic
1014631346 6:123794307-123794329 GGTTCTTGACATATGGTCAATGG - Intergenic
1014969858 6:127801180-127801202 GGTTCTCCACATATGGTCAAAGG - Intronic
1015467319 6:133561235-133561257 GGTTCTCCACATATGGTCAAAGG + Intergenic
1016143927 6:140646541-140646563 GGTTCTCCACATATGGTCAATGG - Intergenic
1016201165 6:141410224-141410246 GGCTCTAAACATATTCTGCAGGG + Intergenic
1016219815 6:141654549-141654571 GGATCTCCACATATGGTCAAAGG - Intergenic
1018599471 6:165524509-165524531 GGTTCTCCACATATGGTCAAAGG - Intronic
1018685335 6:166299701-166299723 GGTTTTAAATCTATGGTCCATGG + Intergenic
1018777047 6:167027266-167027288 TGCTCTCAACATATGGCCCAGGG - Intronic
1020348093 7:7186410-7186432 GGTTCTAAAAATGTGGTCCCTGG + Intronic
1021719634 7:23492700-23492722 GGGTTTTAACCTAGGGTCCATGG - Intergenic
1023746101 7:43323840-43323862 GGGTTTCACCATATGGGCCAGGG - Intronic
1025761764 7:64402469-64402491 GGTTCTCCACATATGGTCAAAGG - Intergenic
1027407200 7:77874081-77874103 GGTTCTCCACATATGGTCAAAGG + Intronic
1027416960 7:77983763-77983785 GGGTCTCACCTTATTGTCCAGGG + Intergenic
1028043479 7:86088445-86088467 GGTTCTCCACATATGGTCAAAGG - Intergenic
1030277060 7:107733084-107733106 GGTTCTCCACATATGGTCAAAGG - Intergenic
1030368156 7:108669934-108669956 GGTTCTCCACATATGGTCAAAGG - Intergenic
1031065588 7:117101553-117101575 GGTTCTCCACATATGGTCAAAGG + Intronic
1031676193 7:124615339-124615361 GGTTCTCCACATATGGTCAAAGG - Intergenic
1032143070 7:129351750-129351772 GGTTCTCAAAATGTGGTCCATGG + Intronic
1032153510 7:129449959-129449981 GGTTCTCCACATATGGTCAAAGG + Intronic
1038665444 8:29533371-29533393 GGTTCTCCACATATAGTCCAAGG - Intergenic
1040916529 8:52570844-52570866 GGGTCTCCACATATGGTCAAAGG + Intergenic
1043260341 8:78187173-78187195 GGTTCTTCACATATGGTCAAAGG + Intergenic
1043504287 8:80887180-80887202 GGTTCTCAAAGTATGGTCCATGG + Intergenic
1043539414 8:81242751-81242773 GGTTCTTCACATATGGTCAAAGG + Intergenic
1044150421 8:88770116-88770138 GGTTCTGTACATATGGTCAAAGG - Intergenic
1044633823 8:94302824-94302846 GGTTCTCCACATATGGTCAAAGG + Intergenic
1045221374 8:100203640-100203662 GGTTCTCCACATATGGTCAAAGG - Intronic
1046418040 8:113940844-113940866 GGTTCTCCACATATGGTCAAAGG + Intergenic
1046586167 8:116150644-116150666 GGTTCTCCACATATGGTCAAAGG + Intergenic
1046678348 8:117137976-117137998 GGGTAAAAAAATATGGTTCATGG - Intronic
1049860654 8:144896165-144896187 GGGTCTCACTATATTGTCCAGGG - Intronic
1050376345 9:4977479-4977501 GGCTCTCAAAATGTGGTCCATGG - Intergenic
1050482263 9:6099583-6099605 GGTTCTCCACATATGGTCAAAGG - Intergenic
1051793435 9:20835609-20835631 CAGTCTAAACAAATTGTCCAGGG + Intronic
1052151824 9:25126538-25126560 GGTTCTCTACATATGGTCAAAGG + Intergenic
1056314679 9:85376275-85376297 GGTTCTCCACATATGGTCAAAGG + Intergenic
1056671187 9:88628448-88628470 GGTTCTCAAAGTATGGTCCAGGG - Intergenic
1057316183 9:93970109-93970131 GGTTCTCCACATATGGTCAAAGG - Intergenic
1057482175 9:95453552-95453574 GGGTGCAAACATGTGCTCCAGGG + Exonic
1062025293 9:134337470-134337492 GGGTTAAAACATCTGGTCCAAGG - Intronic
1186294796 X:8137348-8137370 GGTTCTCCACATATGGTCAAAGG + Intergenic
1187212306 X:17243556-17243578 GCTTCTCAAAATATGGTCCATGG - Intergenic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1187698906 X:21946207-21946229 GGGTCTCAACCTGGGGTCCATGG - Intronic
1190576042 X:51839908-51839930 GGTTCTCAAAATGTGGTCCAGGG + Intronic
1191072154 X:56411811-56411833 GGTTCTCAAAATATGGTCCCTGG + Intergenic
1191719635 X:64218686-64218708 GGTTCTCCACATATGGTCAAAGG + Intergenic
1191758979 X:64626871-64626893 GGTTCTCCACATATGGTCAAAGG - Intergenic
1191941609 X:66486879-66486901 GGTTCTCCACATATGGTCAAAGG + Intergenic
1191945873 X:66534881-66534903 GGTTCTCCACATATGGTCAAAGG - Intergenic
1192298107 X:69871010-69871032 GGTTCTCCACATATGGTCAAAGG + Intronic
1192898517 X:75470446-75470468 GGTTCTCCACATATGGTCAAAGG - Intronic
1192940720 X:75909097-75909119 GGTTCTTTACATATGGTCAAAGG - Intergenic
1192995850 X:76512558-76512580 GGATCTCCACATATGGTCAAAGG - Intergenic
1193915258 X:87355236-87355258 GGTTCTCCACATATGGTCAAAGG + Intergenic
1194604782 X:95965005-95965027 GGTTCTCCACATATGGTCAAAGG + Intergenic
1196275423 X:113761086-113761108 GGTTCTCCACATATGGTCAAAGG - Intergenic
1197001914 X:121450021-121450043 GGTTCTCCACATATGGTCAAAGG - Intergenic
1197044080 X:121975424-121975446 GGGTCTCCACATATGGTTGAAGG - Intergenic
1197477753 X:126944353-126944375 GGTTCTCCACATATGGTCAAAGG + Intergenic
1197591476 X:128416322-128416344 GGTTCTCCACATATGGTCAAAGG - Intergenic
1197977275 X:132179356-132179378 GGTGCTGAACATCTGGTCCAAGG - Intergenic
1198080658 X:133236220-133236242 GGTTCTCAACATGTGGTCCATGG + Intergenic
1198320570 X:135515448-135515470 AGGTGGAAACAAATGGTCCAAGG + Intergenic
1200840478 Y:7776544-7776566 GGCCCTAAAGATATGCTCCAGGG + Intergenic
1200973421 Y:9180585-9180607 GGTTCTCCACATATGGTCAAAGG + Intergenic
1202137659 Y:21683924-21683946 GGTTCTCCACATATGGTCAAAGG - Intergenic