ID: 1081227344

View in Genome Browser
Species Human (GRCh38)
Location 11:40540559-40540581
Sequence CTCTGCAGGTGGAGGTGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 484
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 442}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081227344_1081227351 -3 Left 1081227344 11:40540559-40540581 CCCTGACACCTCCACCTGCAGAG 0: 1
1: 0
2: 4
3: 37
4: 442
Right 1081227351 11:40540579-40540601 GAGTTCTAAAATTTAGGTAAGGG 0: 1
1: 1
2: 0
3: 11
4: 195
1081227344_1081227350 -4 Left 1081227344 11:40540559-40540581 CCCTGACACCTCCACCTGCAGAG 0: 1
1: 0
2: 4
3: 37
4: 442
Right 1081227350 11:40540578-40540600 AGAGTTCTAAAATTTAGGTAAGG 0: 1
1: 0
2: 0
3: 21
4: 237
1081227344_1081227349 -9 Left 1081227344 11:40540559-40540581 CCCTGACACCTCCACCTGCAGAG 0: 1
1: 0
2: 4
3: 37
4: 442
Right 1081227349 11:40540573-40540595 CCTGCAGAGTTCTAAAATTTAGG 0: 1
1: 0
2: 1
3: 9
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081227344 Original CRISPR CTCTGCAGGTGGAGGTGTCA GGG (reversed) Intronic
900351797 1:2238516-2238538 CTCTGCAGAGGGAAGTCTCAAGG - Intronic
900985554 1:6071240-6071262 CTCCGAAGTTGGAAGTGTCATGG + Intronic
901271528 1:7955529-7955551 CTCTGCCTGTGGAGGTCACAAGG - Intronic
901320866 1:8339194-8339216 TTCTGCAGGTGGAGGGGTCTTGG - Intronic
901625864 1:10624702-10624724 CTCTGCCTGTGGAGATCTCATGG + Intronic
903456493 1:23490907-23490929 TTCAGCAGGTGGGGGGGTCATGG - Intergenic
904279220 1:29407006-29407028 CCCTGCAGGTGTAGGTGCAAAGG + Intergenic
904743408 1:32695795-32695817 CTCTGCATGTGGAGGAGCCTGGG - Exonic
906513808 1:46426391-46426413 CTCGGGAGGTGGAGGTTGCAGGG - Intergenic
906667335 1:47631299-47631321 CTAGACAGGTGGAGATGTCACGG - Intergenic
907124199 1:52034837-52034859 CTCAGGAGGTGGAGGTTGCAGGG - Intronic
907827541 1:58033151-58033173 CTCTCCAGATGGATTTGTCAGGG + Intronic
908789893 1:67770802-67770824 CTCTCCAGGTTGTGGGGTCAGGG - Intronic
912616096 1:111101804-111101826 CTGTTCTGGTGGAGGTGGCAGGG + Intergenic
914346119 1:146799742-146799764 CTCTTCTGGCGGAGGTGGCAGGG - Intergenic
914576974 1:148981287-148981309 CTCTGCAGGTGGAACTGGAAGGG + Exonic
915064552 1:153214058-153214080 CCCAGCAGGTGGAGGTTGCAGGG - Intergenic
915673245 1:157508298-157508320 ACATGCAGGTGGAGATGTCAAGG - Intergenic
917047141 1:170873550-170873572 CTCTGCAGGGGGAGGGGAAAAGG - Intergenic
917236002 1:172892627-172892649 CACTGCAGGTGGGGGTGGAATGG - Intergenic
918015999 1:180632562-180632584 AGCTGCAGGTGGGGGAGTCACGG + Intronic
918070536 1:181130783-181130805 CACAGCTGGTGGGGGTGTCAGGG + Intergenic
918114528 1:181484903-181484925 CTCTGATGGTGGTGGTGTCAGGG + Intronic
918116189 1:181500029-181500051 CTGTGCAGCTGGAGGTGTGTCGG - Intronic
918244195 1:182644505-182644527 GGCTGCAGATGGTGGTGTCATGG - Intergenic
918750714 1:188266145-188266167 CTGTTCCAGTGGAGGTGTCAGGG + Intergenic
919527534 1:198672543-198672565 CCCTGGAGGTGGAGGTTGCAGGG - Intronic
919630556 1:199956431-199956453 CTTTTCAGGTGGATGAGTCAGGG - Intergenic
923767661 1:236907427-236907449 ATCTGCAGGGGGAGATGTCTGGG - Intergenic
1062851089 10:744052-744074 CTCTCCACGTGGAGGAGCCATGG + Intergenic
1063566428 10:7175254-7175276 CACAGGAGGTGGAGGTGTCTGGG + Intronic
1065897475 10:30176788-30176810 CTTTGCATGTGGATGTGTCAGGG - Intergenic
1066244544 10:33569768-33569790 CTCTGGAGATGGAGGTGTAGAGG + Intergenic
1066834432 10:39798575-39798597 ATCTGCAAGTGGAGATTTCAAGG + Intergenic
1069862969 10:71482620-71482642 CTGGGCAGGTGGAGGGGTTAGGG + Intronic
1070056503 10:72940143-72940165 GTCTGGAGGTGAAGGTGTGAGGG - Intronic
1070753147 10:78975680-78975702 TTGTGCAGGTGGAGGGGGCAGGG - Intergenic
1071670990 10:87609386-87609408 CACTGCAGGTAAAAGTGTCAGGG + Intergenic
1072131099 10:92495137-92495159 CTCAGGAGGTGGAGGTTCCAGGG - Intronic
1072580017 10:96732847-96732869 CCCAGGAGGTGGAGGTTTCAGGG + Intergenic
1072744013 10:97927541-97927563 CTTTTCAGCTGGAGGTGTTAGGG + Intronic
1073700913 10:105925683-105925705 CTGTGCTGGTGGAGGTGGCAGGG - Intergenic
1074120063 10:110487505-110487527 CTCTGCAGCTGAAGGAGACAGGG - Intergenic
1075004918 10:118823193-118823215 GTCTGGAGGTGGAGGTTTGAGGG + Intergenic
1075118366 10:119646231-119646253 CTCTCCAGGTGGAGGAAGCAGGG + Intergenic
1075314230 10:121439151-121439173 TTCTTCAGGTGGCAGTGTCAAGG - Intergenic
1075879454 10:125837862-125837884 CACTGCAGTTGGAGCTGTCGGGG - Intronic
1076666253 10:132094633-132094655 CTGTTCCGGTGGAGGTGGCAGGG + Intergenic
1076677254 10:132153529-132153551 CTCTCCTGGAGAAGGTGTCAGGG + Intronic
1076801618 10:132833648-132833670 ATCTGGAGGAGGAGGTGGCATGG - Intronic
1076883459 10:133250963-133250985 CTCTGCAGGTGGAGGAGCCCAGG + Intergenic
1077162552 11:1120344-1120366 CCCAGCAGGTGGAGGCTTCAGGG - Intergenic
1077368237 11:2169891-2169913 CTCAGCAGGTGGAGGAGGCATGG - Intronic
1079690620 11:23412624-23412646 CCCTGTAGGTGGAGGTTGCAGGG - Intergenic
1080508829 11:32946489-32946511 CCCTGCAGTGTGAGGTGTCAGGG + Intronic
1081227344 11:40540559-40540581 CTCTGCAGGTGGAGGTGTCAGGG - Intronic
1081540710 11:44032720-44032742 CTCTGCAGGTCCAGGTTTGAGGG + Intergenic
1081793477 11:45804771-45804793 CTCCGGAGGTGGAGGGGTCCAGG + Exonic
1082043895 11:47709334-47709356 CTCTGAGGGTGGGGGTGTAAGGG + Intronic
1083110500 11:60401481-60401503 CTATGCAGATGGAGGTGTGCAGG + Intronic
1083845279 11:65328396-65328418 CTCTGGAGGCTGAGGTGGCAAGG + Intergenic
1083990903 11:66245111-66245133 CTCTGCAGGTGGAGGGAATAGGG + Intergenic
1084044561 11:66561258-66561280 CACTGCAGGAGGAGCTGGCACGG + Exonic
1084700746 11:70784926-70784948 CCCTGCAGGCTGAGCTGTCAGGG + Intronic
1085048049 11:73364587-73364609 CGCTGCAGCTGGAGGTAGCAGGG + Exonic
1086100570 11:83095013-83095035 CTTTGCTGGTGGAGGAGTTAAGG + Intergenic
1087119095 11:94554198-94554220 CTCTCCAGGTGGACATGACATGG + Intronic
1088678379 11:112218340-112218362 CATTGCTGCTGGAGGTGTCATGG + Exonic
1089337552 11:117735453-117735475 CTCTTCAGGGGCAGGTGTCTTGG - Intronic
1089662354 11:119993817-119993839 TTGTTCAGGTGGTGGTGTCAGGG - Intergenic
1089952854 11:122546367-122546389 CTGTTCTGGTGGAGGTGACAAGG + Intergenic
1090074348 11:123570497-123570519 CCCAGGAGGTGGAGGTTTCAGGG - Intronic
1090132468 11:124159119-124159141 CGCTGCAGGTGGAGAAGGCACGG - Intergenic
1090134782 11:124185974-124185996 CACTGCAGGTGGAGAAGGCACGG - Exonic
1090519739 11:127465500-127465522 CTGACCAGGTGGCGGTGTCAGGG + Intergenic
1091572288 12:1698179-1698201 CTCAGCAGGTGGTGCTGTCTTGG + Intronic
1091757297 12:3062404-3062426 ATCTGCAAGTGGAGGTTTGAAGG - Intergenic
1092677804 12:10942107-10942129 CTGTTCTGGTGGAGGTGGCAGGG + Intronic
1093210676 12:16304569-16304591 CTCTGCTTTTGGAGGTCTCAGGG - Intergenic
1093409216 12:18844980-18845002 CTCTTCTGGTGGAGGTGGCAGGG + Intergenic
1093488682 12:19681064-19681086 CTCTTCTGGTGGAGGTGGCAGGG + Intronic
1093991468 12:25593314-25593336 CTGTTCTGGTGGAGGTGGCAGGG - Intronic
1094447307 12:30545911-30545933 CTGTGCTGGTAGAGGTGGCAGGG + Intergenic
1094883547 12:34833695-34833717 ATTTGCAGGTGGAGATTTCAAGG - Intergenic
1094900961 12:35116154-35116176 ATTTGCAGGTGGAGATTTCAAGG + Intergenic
1094905391 12:35187481-35187503 ATTTGCAGGTGGAGATTTCAAGG + Intergenic
1094919605 12:35417435-35417457 ATTTGCAGGTGGAGATTTCAAGG + Intergenic
1094941799 12:35777272-35777294 ATTTGCAGGTGGAGATTTCAAGG + Intergenic
1094989644 12:36551163-36551185 ATTTGCAGGTGGAGATTTCAAGG + Intergenic
1095007764 12:36844378-36844400 ATTTGCAGGTGGAGATTTCAAGG + Intergenic
1095115337 12:38345166-38345188 CTGTTCCGGTGGAGGTGGCAGGG - Intergenic
1095626179 12:44318026-44318048 CTCTGCATGGGGAGGGGTGACGG + Intronic
1096115364 12:49051922-49051944 CTCTTCAGGTGGAGGGGACATGG + Exonic
1096956897 12:55535108-55535130 CTGTTCTGGTGGAGGTGGCAAGG - Intergenic
1097179049 12:57160524-57160546 GGCTGCAGGTGGGGGTGTCAGGG - Intronic
1099477111 12:83121540-83121562 CTGTTCTGGTGGAGGTGGCAGGG + Intronic
1099687391 12:85907796-85907818 CTGTTCTGGTGGAGGTGGCATGG + Intergenic
1100077096 12:90798740-90798762 CTCTGGAGGTGGTGGTGTGAGGG - Intergenic
1100106200 12:91175999-91176021 TTCTGCAGATGGAGATGTCAAGG + Intronic
1101258611 12:103005960-103005982 TATTGCAGGTGGAGATGTCAGGG - Intergenic
1101635217 12:106535191-106535213 CTGTTCTGGTGGAGGTGGCAGGG + Intronic
1101675757 12:106914777-106914799 CCCTGTAGGTGGAGGCTTCATGG + Intergenic
1102515235 12:113441818-113441840 CCCTGGAGGTGGAGGTGTTAGGG - Intergenic
1103094199 12:118119656-118119678 CTCTGCTGGACGAGATGTCAGGG + Intronic
1103188380 12:118980842-118980864 CTGTGCATGCGGAGCTGTCAAGG - Intergenic
1103595890 12:122023998-122024020 CTCTGCGGGAGCAGCTGTCAGGG - Intronic
1104509251 12:129361028-129361050 CTTTGCAGGTGGAAGTGTCCCGG - Intronic
1104594790 12:130113682-130113704 CTCTGCAGGGCCCGGTGTCAGGG - Intergenic
1104681795 12:130757206-130757228 CTCTGGAGGAGGAGATGACAAGG + Intergenic
1105443565 13:20434620-20434642 CGCTGCAGGTGGGGGTGTAGGGG - Intronic
1106295202 13:28407016-28407038 CTCTGCAGGAGGACGTTACAGGG - Intronic
1107217463 13:37937815-37937837 CCCAGCAGGTGGAGGTTGCAGGG + Intergenic
1107511284 13:41088046-41088068 CTCAGCAGGTCGAGGTTGCAGGG - Intergenic
1107755948 13:43622632-43622654 CTGTTCTGGTGGAGGTGGCAGGG + Intronic
1107954527 13:45497708-45497730 CCCGGGAGGTGGAGGTTTCAGGG + Intronic
1108313268 13:49216102-49216124 CTCTGCAGCTGGTGGTGCTATGG + Intergenic
1110458112 13:75712452-75712474 CTCTGAAGGGGGAGGTGGCTGGG - Intronic
1112368792 13:98776681-98776703 CTCAGGAGGTGGAGGTTGCAGGG + Intergenic
1112758265 13:102664694-102664716 CACTGCAGTTGTAGGTCTCATGG + Intronic
1112799964 13:103099788-103099810 TTCTGCCAGTGGTGGTGTCAGGG + Intergenic
1113124098 13:106957495-106957517 CTCTGCTGGTGGAGGACTCTGGG - Intergenic
1113137868 13:107113720-107113742 CCCTGGAGGAGGAGGTGTCTTGG + Intergenic
1113575267 13:111390743-111390765 CTCTGCCTGAGGAGGTGTGAGGG + Intergenic
1113895979 13:113764701-113764723 CTCTGCAGGGGCAGGGGTGAAGG + Intronic
1115163879 14:30426264-30426286 CTCTGCCTGAGGAGGTGGCATGG + Intergenic
1115246587 14:31301891-31301913 CCCTGGAGGTGGAGGTTTCAGGG - Intronic
1115684183 14:35777636-35777658 CCCTGGAGGTGGAGGTTGCAGGG - Intronic
1115709092 14:36030260-36030282 CTCTTCAGGTGGAGGTGCCTAGG + Intergenic
1115996971 14:39204461-39204483 CTGTTCTGGTGGAGGTGGCAGGG - Intergenic
1116495707 14:45557466-45557488 CTCTGCAGGTAGAGTGGTGAAGG - Intergenic
1118323076 14:64764694-64764716 GTCTGCATGTGGCGGTGTCCTGG - Intronic
1118604059 14:67490240-67490262 CTCTGCAGGTGAAGGAAGCAAGG + Intronic
1119668595 14:76501514-76501536 CTGTGCAGATGGAAGTGGCAGGG + Exonic
1119748928 14:77064138-77064160 CTCCATAAGTGGAGGTGTCAGGG + Intergenic
1119833137 14:77721821-77721843 CCCTGGAGGCGGAGGTTTCAGGG - Intronic
1120489651 14:85161262-85161284 CTGTTCCGGTGGAGGTGGCAGGG - Intergenic
1120591558 14:86380350-86380372 CTCTACAGATGGAGGTGTTGAGG - Intergenic
1121071645 14:91028323-91028345 CTCTGCAGGCTGAGGTGAAAGGG - Intronic
1121551267 14:94803108-94803130 CTCTGGAAGTGGAGGTTGCAGGG + Intergenic
1121677594 14:95766781-95766803 CTCTGCACTTGGAGGTGGGATGG - Intergenic
1122695056 14:103548418-103548440 CTCTGCACGTGGGGATGTAAAGG - Intergenic
1122757948 14:103997511-103997533 ATGTTCAGGTGGAGGTGTCATGG + Intronic
1123631459 15:22262978-22263000 AGCTGCAGGTGGAGGTGGCAGGG + Intergenic
1124553046 15:30699886-30699908 CTGTGCAAGAGTAGGTGTCAGGG - Intronic
1124678197 15:31705784-31705806 CTGTGCAAGAGTAGGTGTCAGGG + Intronic
1125605155 15:40936116-40936138 CTCTGCAGGTGGAGGTAGAAGGG + Intronic
1125719862 15:41840150-41840172 CTCTGCAGGCAGAGGTGTCCAGG + Exonic
1125960031 15:43822447-43822469 CCCGGCAGGTGGAGGTTTCATGG - Intronic
1127483150 15:59395756-59395778 CTATGCAGGGGCAGGTGACAAGG - Intronic
1128811093 15:70573316-70573338 CTCTGCCGATGGAGCTGTGAAGG - Intergenic
1130460425 15:84155609-84155631 CTCAGCATGTGAAGGTGGCAGGG - Intergenic
1130890202 15:88127313-88127335 TTCTGCAGGGGGAAGTCTCAAGG - Intronic
1130969648 15:88721923-88721945 CTCTGCAAGTGCAGGTGTGGTGG - Intergenic
1131599728 15:93834554-93834576 CTCTGGAGGTGGAGGTTGTAGGG + Intergenic
1132476786 16:143257-143279 CTGAGAAGGTGGAGGTGTCCAGG - Intergenic
1132610678 16:814429-814451 CCCTGGAGGTGGAGGTTGCATGG + Intergenic
1133203153 16:4217012-4217034 CTTGGCAGGTGAAGGGGTCAAGG + Intronic
1133984346 16:10656846-10656868 CTCAGGAGGTGGAGGTGGGAGGG - Intronic
1134102298 16:11460918-11460940 CGGGGCAGGTGGAGGTGGCAGGG - Intronic
1135552974 16:23412508-23412530 CTCTCCAGCTGGACATGTCAAGG + Intronic
1135901645 16:26465176-26465198 CAGTGGAGGTGGAGGTGGCAGGG - Intergenic
1136673017 16:31874546-31874568 CTATGCAGGTGGAGGTGAATTGG + Intronic
1137001385 16:35233567-35233589 CTCTGCAGGAGGTGGCTTCAGGG - Intergenic
1138053883 16:53812188-53812210 CTCTGGTTGTAGAGGTGTCAGGG - Intronic
1138108823 16:54307138-54307160 CTCTGCTGGCTGGGGTGTCATGG - Intergenic
1138175872 16:54897758-54897780 CTCAGCATCTGGATGTGTCAAGG - Intergenic
1138599955 16:58048240-58048262 CTCTGGACGTGGGGGAGTCAGGG - Intergenic
1139409264 16:66745826-66745848 CTCGGGAGGTGGAGGTTGCAGGG + Intronic
1139671006 16:68492553-68492575 CTGTGCAGGTGCAGGAGTCCAGG + Intergenic
1139969418 16:70764451-70764473 CTGTGCAGGTAGAGGAGTCTAGG + Intronic
1139987860 16:70915525-70915547 CTCTTCTGGCGGAGGTGGCAGGG + Intronic
1139995936 16:70979846-70979868 CCCTGGAGGTGGAGGTTGCAGGG + Intronic
1141469246 16:84227499-84227521 CTCAGGAGGTGGAGGTTGCAGGG + Intronic
1141733476 16:85837399-85837421 CACTGGAGGTGGTGGTGTCATGG + Intergenic
1141971551 16:87487493-87487515 AGCTGCAGCTGGAGGTGGCAGGG - Intronic
1142617659 17:1145857-1145879 TTCTGCAGGTGTATGTGTGAAGG - Intronic
1142707106 17:1702423-1702445 CTCAGGAGGTGGAGGTTACAGGG - Intergenic
1143383664 17:6511867-6511889 CCCAGGAGGTGGAGGTTTCAAGG + Intronic
1143595123 17:7909423-7909445 TTCAGCAGGTAGAGGGGTCAGGG - Intronic
1143990884 17:10960192-10960214 CTCTTCCAGTGGAGGTGGCAGGG - Intergenic
1144243124 17:13334058-13334080 CTCTTCAGGTGGTGTGGTCACGG - Intergenic
1144573995 17:16417609-16417631 CTGTGCAGATGGAGATGTCAAGG - Exonic
1145728519 17:27155351-27155373 CTTTGCAGGTGGAGGTGATTTGG + Intergenic
1145871240 17:28275169-28275191 CGCTGGGGGTGGAGGTGGCAAGG + Intergenic
1145906932 17:28521457-28521479 CTCTCCAGGAGGAGCTGTCCAGG + Intronic
1146059172 17:29595586-29595608 CGCTGCAGGTAGAGGTGTTGGGG + Intronic
1146185631 17:30722493-30722515 CTCTGGAGGGGGAGGTGTTACGG - Intergenic
1146247674 17:31304272-31304294 TTCTGCAGGTGGAGGTGGCAGGG + Exonic
1146624506 17:34425161-34425183 CTTTGCAGGGGGAGGTGGTAGGG - Intergenic
1146683969 17:34827967-34827989 CTGAGCAGGTGGAGGGGTGATGG + Intergenic
1147564356 17:41527564-41527586 CTCTGGAGGTGGCGGGGGCAAGG - Intronic
1148349697 17:46931647-46931669 CGCTGGGGGTGGAGGTGGCAAGG - Intronic
1148485736 17:47989790-47989812 CTCTGTAGATGGAGGAATCATGG + Intergenic
1149091928 17:52794099-52794121 CTCTGGAGGCTGAGGTGTGAGGG - Intergenic
1151749701 17:76029502-76029524 CTGTGCAGGGGGAGGTGCCCTGG + Intergenic
1151929709 17:77224567-77224589 CTCTGCAGATGGAGCTGGAAGGG - Intergenic
1152158524 17:78651329-78651351 CTCGGGAGGTGGAGGTTGCAGGG + Intergenic
1152587949 17:81197485-81197507 CTCTCAGGGTGGAGGTGGCAGGG - Intronic
1152823485 17:82449275-82449297 CTCTACAGGAGGAGGGGTCTGGG + Exonic
1153168928 18:2293204-2293226 CTGTTCTGGTGGAGGTGGCAGGG + Intergenic
1155294846 18:24375649-24375671 ATCTGGAAGTGCAGGTGTCATGG - Intronic
1156382511 18:36577376-36577398 CTCAGGAGGTGGAGGTTGCAGGG - Intronic
1156893315 18:42215212-42215234 CTCCTCTGGTGGAGGTGGCAGGG + Intergenic
1158247978 18:55453125-55453147 CTCTGCAGCTGGAGATGGCCTGG + Intronic
1158408801 18:57186440-57186462 CTCTGCTGGTGGAGGAGGCAAGG + Intergenic
1158417991 18:57266702-57266724 TTCTGCAGGGGGAGGATTCAGGG - Intergenic
1158518544 18:58150930-58150952 TTTTGGAGGTGGAGGAGTCAAGG - Intronic
1159242398 18:65759318-65759340 CTCGGGAGGTGGAGGTTTCAGGG - Intronic
1160345575 18:78129181-78129203 CCCAGAAGGTGGAGGTGTCGGGG + Intergenic
1160393031 18:78549260-78549282 GTGTGCAGGTGTAGGTGTGAGGG - Intergenic
1160583303 18:79899842-79899864 CGCTGCAGCTGGAGGGGGCAGGG - Intronic
1160854232 19:1208990-1209012 CTCTGGAGCTGGAGCAGTCAGGG + Intronic
1161388324 19:4008336-4008358 CCGTCCAGGTGGAGGAGTCAGGG + Intronic
1161777270 19:6270407-6270429 CTCAACAGCTGGAGGTGACACGG + Intronic
1161791479 19:6362425-6362447 ATCTGCAGGTGGAGAGGGCAGGG - Exonic
1163821803 19:19500282-19500304 AGCTGCAGGTGGCGGTCTCATGG + Intronic
1165245545 19:34496560-34496582 CTGAGCAGCTGGAGGAGTCAGGG + Intronic
1165825931 19:38705756-38705778 CCCAGGAGGTGGTGGTGTCAGGG - Intronic
1166565208 19:43760824-43760846 CTCGGGAGGTGGAGGTTGCAGGG - Intergenic
1167050661 19:47075914-47075936 CTTTGCTGGTGGAGGGGCCAGGG - Intronic
1167268652 19:48495960-48495982 CTATGGTGGTGGAGTTGTCAGGG + Intronic
1167792910 19:51691980-51692002 CTCTGGAGTGGGAGGTGTCAGGG + Intergenic
1167795467 19:51705358-51705380 TTCTGCAGATGGAAATGTCAAGG - Intergenic
1167871761 19:52376583-52376605 CTCGGGAGGTGGAGGTTGCAGGG - Intronic
1168089622 19:54074060-54074082 CTCTGCAGCTGGATGGGTGATGG + Exonic
1168189568 19:54727806-54727828 CCCTGCAAGGGCAGGTGTCATGG - Exonic
925218404 2:2117063-2117085 CTCTGCAGGGGGAGAGGTCCAGG - Intronic
925274801 2:2641207-2641229 CTCTGCAGGAGGAGCCGTAAGGG - Intergenic
925343368 2:3151762-3151784 CTGTTCTGGTGGAGGTGGCAGGG - Intergenic
925372209 2:3354604-3354626 TTCTGCAGTTTGAGGTGTTAAGG + Exonic
925614737 2:5734647-5734669 CTCTGTAAGTGGAGAAGTCAAGG - Intergenic
926073800 2:9923899-9923921 CTCTGCAGCTGGAGGAGGCAGGG - Intronic
926398289 2:12468348-12468370 CTTTGCAGGTGGAGAGGACAAGG + Intergenic
927328291 2:21832221-21832243 CTGTTCCGGTGGAGGTGGCAGGG + Intergenic
927363449 2:22264508-22264530 CTGTTCTGGTGGAGGTGGCAGGG + Intergenic
928472992 2:31592455-31592477 CTGCTCTGGTGGAGGTGTCAGGG - Intergenic
929021433 2:37557504-37557526 AACTGCAGTTGGAGGGGTCAGGG + Intergenic
931993073 2:67810076-67810098 CTGTTCTGGTGGAGGTGGCAGGG - Intergenic
932699256 2:73982235-73982257 CTGAGCAGCTGGAGGTTTCATGG + Intergenic
933730234 2:85450702-85450724 CACTGCAGGTGGCTGTGTGAGGG + Intergenic
935131729 2:100265646-100265668 CTCTGCAGGTTGAAATGTCTGGG - Intergenic
937137309 2:119564984-119565006 CACTGCAGGTGGGTGTGTAAAGG - Intronic
938482196 2:131671913-131671935 CGCTGCTGGTGGAGCTGGCAGGG + Intergenic
939556943 2:143686306-143686328 CCCTGGAGGTGGAGGTTGCAGGG + Intronic
939896384 2:147796537-147796559 CTCTGCAGGTGGGGGTGGGGAGG - Intergenic
940217579 2:151316109-151316131 CTGTTCTGGTGGAGGTGGCAGGG - Intergenic
942124106 2:172805737-172805759 ATCTGGAGGTGGATGTGTCCTGG - Intronic
942632089 2:177961346-177961368 CTCAGCAGGCTGGGGTGTCAGGG - Intronic
942743681 2:179207491-179207513 CTGCTCAGGTGGAGGTGGCAGGG - Intronic
944841907 2:203632459-203632481 TACTGCAGCTGGAGGTATCATGG - Intergenic
946007753 2:216540142-216540164 CAATGCAGGGGAAGGTGTCAAGG - Intronic
946103650 2:217350885-217350907 CTGTGCTGGTGGGGGTGTCAAGG + Intronic
947104066 2:226649977-226649999 CTCAGTGGGTGGTGGTGTCAAGG + Intergenic
947198647 2:227595438-227595460 CTCTGCAAGTGTGGCTGTCAAGG + Intergenic
947548180 2:231027102-231027124 CTCTGGAGGTGGGGGTGTTTGGG - Intergenic
947755817 2:232564239-232564261 CTCTGCAGGTGGAGCAGTTCTGG + Exonic
948521933 2:238544946-238544968 CACTGCAGCAGGAGGTGTCTTGG - Intergenic
948522210 2:238547115-238547137 CACTGCACTTGGAGGTGTCTTGG - Intergenic
948699381 2:239750693-239750715 CCCTCCAAGTGGAGGTGTCCAGG - Intergenic
948828960 2:240588198-240588220 GTCTTCAGGTGGAGCTGTCCTGG + Intronic
949063549 2:241975280-241975302 CTCTGCGCGTGGAGGTGTGTTGG + Intergenic
1169401370 20:5283243-5283265 CTGTTCTGGTGGAGGTGGCAGGG - Intergenic
1172050826 20:32116427-32116449 TTCTGCACTTGGTGGTGTCAGGG + Intronic
1172095523 20:32458288-32458310 CTGCTCAGCTGGAGGTGTCATGG - Intronic
1172777816 20:37417541-37417563 GTCTGCAGGGGGAGGTGACTTGG - Intergenic
1173005197 20:39134892-39134914 CTGAGCAGGTGCACGTGTCACGG - Intergenic
1174280786 20:49437609-49437631 CCCTGCAAGTGGAGGTTCCATGG - Intronic
1174778836 20:53370044-53370066 TTCTGTAGGTGGGAGTGTCACGG + Intronic
1175511086 20:59526494-59526516 GACTGCAGGTGGAGGTCCCAGGG + Intergenic
1175880035 20:62252539-62252561 CTCTGCTGGGCGAGGTGCCAGGG + Intronic
1176411453 21:6451487-6451509 CCCTGCAGGTGCAGGGGACAGGG + Intergenic
1179474459 21:41634335-41634357 ACCTGCAGGTGGAGGACTCATGG + Intergenic
1179686946 21:43059809-43059831 CCCTGCAGGTGCAGGGGACAGGG + Intronic
1179887905 21:44322260-44322282 CCCTGCAGGTGGGGGCGGCAAGG + Intronic
1181384168 22:22531637-22531659 CTCGGGAGGTGGAGGTTGCAAGG - Intergenic
1181726117 22:24812092-24812114 CCCGGGAGGTGGAGGTGGCAGGG + Intronic
1182318584 22:29463871-29463893 CTCTGCAGGTGGAGGAATGCGGG + Intergenic
1183390729 22:37544480-37544502 CTCGGGAGGTGGAGGTTGCAGGG - Intergenic
1184024060 22:41840878-41840900 CTCTGCAGGCTCAGGTGACAAGG - Intronic
1184066303 22:42123745-42123767 CTCTGCAGAGGGAGGTGGGAGGG - Intergenic
1184068771 22:42135897-42135919 CTCTGCAGAGGGAGGTGGGAGGG - Intergenic
1184443869 22:44535857-44535879 CTCTGCTGGTGGAAGTTTCGGGG + Intergenic
949494069 3:4615227-4615249 CTCTCCAGGTGCAGAAGTCAGGG + Intronic
950444513 3:13028569-13028591 CTCTGCAGGTGGCATGGTCATGG + Intronic
950508551 3:13411636-13411658 GTCGGCAGGTGCAGGTGTCTAGG - Intronic
950603501 3:14057510-14057532 CTGTTCTGGTGGAGGTGGCAGGG + Intronic
951217974 3:20041548-20041570 ATCTGCAGCTGGAGGTGACAGGG - Intronic
951765095 3:26188983-26189005 CTCTTCAGGTGTATGTGACAGGG - Intergenic
951943882 3:28112465-28112487 CTCTGCAAGTCAAGCTGTCATGG + Intergenic
953027872 3:39154962-39154984 GCCTGCAGGCGGAGGTGTCTGGG + Intergenic
955218318 3:57003325-57003347 CCCGGGAGGTGGAGGTTTCAGGG + Intronic
955270712 3:57495483-57495505 CTCCAGAGGTGGAGGTTTCAGGG + Intronic
955649013 3:61172966-61172988 CATTGCAGGTGGAGGGGTAAAGG - Intronic
956739288 3:72262544-72262566 CTCTGGAGGGGGAGGTATAAAGG + Intergenic
956760901 3:72443649-72443671 TTCTGCAGGTGGAATTGTTAAGG - Intronic
956890374 3:73607402-73607424 CCCTGCGGGAGGAGGTGTCCTGG - Intronic
957032637 3:75259635-75259657 TTCTGCAAGTGAAGGTCTCAGGG + Intergenic
957418207 3:79933074-79933096 CTCAGCAGGTGGAGGTTATAGGG + Intergenic
957905234 3:86544787-86544809 CTCTACAGTTGGTGGTCTCAGGG + Intergenic
958364976 3:93040485-93040507 ATTTTCAGGTGGAGGTATCAAGG + Intergenic
958394817 3:93528431-93528453 ATTTTCAGGTGGAGGTATCAAGG + Intergenic
958480737 3:94643140-94643162 CTTTTCTGGTGGAGGTGGCAGGG + Intergenic
958839505 3:99186642-99186664 CACTGCAGCTGGAAGTGTGATGG - Intergenic
958925200 3:100149882-100149904 CTCTGCAGGCAGCTGTGTCAGGG - Intronic
959275178 3:104269368-104269390 CTATTCAGGTGGAGGTGTCAGGG + Intergenic
959997329 3:112693730-112693752 TTGTGCTGGTGGAGGTGGCAGGG - Intergenic
960933621 3:122880802-122880824 ATCTGCATGTGGGTGTGTCATGG - Exonic
961047940 3:123722179-123722201 CTAGGCAGGTGTAGGTGCCATGG + Exonic
961496447 3:127295515-127295537 CTCTGCAGGTGGAGGAATGAAGG - Intergenic
961531652 3:127543846-127543868 TTTTGGAGGTGGAGGTGGCAGGG + Intergenic
961833980 3:129641290-129641312 CTCGTAAGGTGGATGTGTCAGGG + Intergenic
962391151 3:134973866-134973888 CTCTGCAGCTGCAGGATTCAAGG + Intronic
962401796 3:135067076-135067098 CTGTTCTGGTGGAGGTGGCAGGG + Intronic
963920065 3:150896765-150896787 CTGTTCTGGTGGAGGTGGCAGGG + Intronic
963949447 3:151182796-151182818 GTCAGCAGGTGGAGGTGCCCAGG + Intronic
964406244 3:156352103-156352125 GTCTGGAGTCGGAGGTGTCAGGG + Intronic
965361933 3:167752285-167752307 CTCTCCAAGTGGATGTCTCATGG + Intronic
965874331 3:173299173-173299195 CTGTTCTGGTGGAGGTGGCAGGG + Intergenic
967653347 3:192014495-192014517 CTCAGGAGGTGGAGGTGGGAGGG - Intergenic
968053660 3:195674129-195674151 CTCTGAAGGTTGAGGTGTTGAGG - Intergenic
968614451 4:1571080-1571102 CACTGCAGGTGGGGGCCTCAGGG + Intergenic
968893732 4:3386279-3386301 CTCTCCAGGTGGAGGTGTCCCGG - Intronic
969183612 4:5460021-5460043 CTCTGAAGGAGGGGGTCTCAGGG - Intronic
969342254 4:6549543-6549565 CTCTGCAGGTGGAGAAGTGGAGG - Intronic
969849056 4:9942436-9942458 GCCTGCATGTGGAGGTGACATGG + Intronic
971318343 4:25585641-25585663 CTCTGGAGGTAGAGGTTGCAGGG - Intergenic
972189023 4:36568328-36568350 CTGTTCCGGTGGAGGTGGCAGGG + Intergenic
972671146 4:41214736-41214758 CCCTGCAGGTGGAGGCGGCAGGG + Intronic
973069107 4:45835374-45835396 CTGTTCTGGTGGAGGTGGCAGGG + Intergenic
973820316 4:54657480-54657502 CGCTGCTCGTGGAGGTGGCATGG - Intergenic
973831510 4:54764544-54764566 CTGTTCTGGTGGAGGTGGCAGGG + Intergenic
974278657 4:59760386-59760408 CTCAGCAGGCGGAGGTTGCAGGG - Intergenic
975880001 4:78893805-78893827 CTCTGGAGGTTGAGGTGAGAGGG - Intronic
976192119 4:82498088-82498110 CCCAGGAGGTGGAGGTTTCAGGG - Intronic
978445471 4:108776149-108776171 CTCTGGAGATGGAGGGCTCAAGG + Intergenic
978798103 4:112728642-112728664 CTCTGAAGGTTGAGGTGAGAGGG + Intergenic
978852846 4:113358556-113358578 CTCTGCAGATGGAGGTGCTGGGG - Exonic
978999375 4:115199124-115199146 CTGTTCTGGTGGAGGTGGCAGGG + Intergenic
980274953 4:130638498-130638520 CTCAGGAGATGGAGGTTTCAGGG - Intergenic
981301077 4:143185827-143185849 TCCTGCAGGTAGAGGTGTTACGG + Exonic
981400929 4:144313289-144313311 CTGTTCTGGTGGAGATGTCAGGG + Intergenic
981647434 4:147016724-147016746 ATCTCCAGATGGAGGGGTCAGGG + Intergenic
982218721 4:153106800-153106822 CTGTTCTGGTGGAGGTGGCAGGG + Intergenic
982312106 4:153997063-153997085 CTGTTCTGGTGGAGGTGGCAGGG + Intergenic
982491795 4:156038988-156039010 CTGTTCCGGTGGAGGTGGCATGG - Intergenic
983397409 4:167217549-167217571 CTCTCCTGGTGGGGGTGTCCTGG + Intronic
983583170 4:169329286-169329308 CACAGCAGGTGGAGATGGCATGG - Intergenic
984080517 4:175243605-175243627 CTCTGCAGGTCCAGATGTGAAGG - Intergenic
984775429 4:183477752-183477774 CTCTGGAGATGGAGGTGTACCGG + Intergenic
984994376 4:185414514-185414536 CTCTGTATGTGGAGGTGACTTGG - Intronic
985561855 5:591963-591985 CTGCTCTGGTGGAGGTGTCAGGG + Intergenic
985693049 5:1323995-1324017 CTCTGCAGGGGGCGGCGTGAGGG + Intronic
985737428 5:1592946-1592968 CTCTGAAGGTTGAGGTGTTGAGG + Intergenic
985791404 5:1930530-1930552 CTGTGCAGGTGCAGGTGTGCAGG + Intergenic
986007814 5:3682991-3683013 ATCTGCAGGTGCAGATCTCAGGG + Intergenic
986534729 5:8775372-8775394 CTCTGCAGGTGGAAGTGTGAGGG - Intergenic
987413866 5:17642661-17642683 CTCTGGAGGTGGAAGTTGCAGGG - Intergenic
988723504 5:33903054-33903076 CTGTTCCGGTGGAGGTGGCAGGG + Intergenic
990148945 5:52794747-52794769 CTTTGCTGGTGGAGGTCACATGG + Intronic
991117429 5:62970314-62970336 CTGTTCTGGTGGAGGTGGCAGGG - Intergenic
991458094 5:66826393-66826415 CTCTGCAGCTCGAGGTGTTTGGG - Intronic
993291988 5:86084246-86084268 CTCTGCAGTAGGAGGTGTGTTGG - Intergenic
995472949 5:112523003-112523025 CTGTTCAGGTGGAGGTGGCTGGG + Intergenic
995524363 5:113038821-113038843 CTCTTCTGGTGGATGAGTCAGGG + Intronic
996288897 5:121828739-121828761 CTGTTCTGGTGGAGGTGGCAGGG + Intergenic
998168557 5:139858651-139858673 CTGTGCAGGTGGAACTGTGAGGG - Intronic
998940915 5:147280889-147280911 CTATTCTGGTGGAGGTGGCAGGG - Intronic
999383688 5:151139569-151139591 CTCATCAGGTGCTGGTGTCAGGG + Intronic
1001567695 5:172711176-172711198 GTGTGCAGGTGGAGGAGGCAAGG - Intergenic
1001600718 5:172926456-172926478 GCCTGGAGGTGGAGGTGTCCTGG + Intronic
1002306824 5:178288469-178288491 CTCTGCAGCGGGAGGACTCAAGG + Intronic
1002928091 6:1616611-1616633 CTCTGCAGGTGGAGGCTGCCTGG + Intergenic
1002941255 6:1718323-1718345 CTTTGCAGGGGGAGGTGTTGAGG - Intronic
1003450935 6:6230695-6230717 CTATTCCGGTGGAGGTGGCAGGG - Intronic
1006559928 6:34902322-34902344 CCCGGCAGGTGGAGGTTGCAGGG - Intronic
1006989186 6:38198980-38199002 CTTTGAAGGTGGAGGTGTGCAGG + Intronic
1007381845 6:41495242-41495264 TACTGTAGGGGGAGGTGTCAGGG - Intergenic
1008637654 6:53427318-53427340 AGCTGTAGGTGGAAGTGTCAGGG + Intergenic
1009968879 6:70605253-70605275 CTGTTCTGGTGGAGGTGGCAGGG - Intergenic
1010237226 6:73585054-73585076 CTCGGGAGGTGGAGGTTGCAGGG - Intergenic
1011168679 6:84479754-84479776 CTGTTCTGGTGGAGGTGGCAGGG - Intergenic
1012382609 6:98638207-98638229 CTGTGCAGGTGGGAGTGTCTTGG + Intergenic
1012427344 6:99129076-99129098 CTCTGCAGCTGGCAGAGTCAGGG + Intergenic
1012930544 6:105311508-105311530 CTGTGCAGTTGGAGTGGTCACGG - Intronic
1013574760 6:111470902-111470924 CTCGGGAGGTGGAGGTTGCACGG + Intronic
1014531339 6:122563350-122563372 CTGTTCTGGTGGAGGTGGCAGGG + Intronic
1014603948 6:123448825-123448847 CTATTCTGGTGGAGGTGGCAGGG - Intronic
1015663259 6:135600126-135600148 CTGTTCTGGTGGAGGTGGCAGGG + Intergenic
1016537271 6:145123015-145123037 CTCTGGAGGTGGAGGTTGCAGGG - Intergenic
1016774036 6:147884374-147884396 CTCTGCAACTGCAGGTGTCCCGG - Intergenic
1016962980 6:149691246-149691268 CTCTGCATGTGCATGTGTCTGGG - Intronic
1017818394 6:158031342-158031364 CTCTGTGGCTGGAGGTGTGAGGG + Intronic
1017889951 6:158629715-158629737 CTCGGCTGGTGGTGCTGTCAAGG - Exonic
1018570559 6:165205289-165205311 CACAGCAAGTGGAGGTGTCCAGG - Intergenic
1019660809 7:2223043-2223065 CTCTGCAGGGAGAGGGGGCATGG + Intronic
1019856462 7:3613274-3613296 CTCTGCAGATAGATGGGTCATGG + Intronic
1020467729 7:8499799-8499821 CTCTGCAGCTGGACGAGCCATGG + Intronic
1021007389 7:15415465-15415487 CCCAGGAGGTGGAGGTTTCAGGG + Intronic
1022687289 7:32608786-32608808 TCCTGCAGGGGGAGGTGTGAGGG + Intergenic
1022859065 7:34347014-34347036 CTCTGCAGGATGAGATGCCATGG + Intergenic
1023130241 7:36995912-36995934 CTCTGCATGGGGAGGAGACAAGG - Intronic
1024182085 7:46906728-46906750 CCCAGGAGGTGGAGGTGGCAGGG + Intergenic
1025095494 7:56092664-56092686 TCCTGCAGATGGAGGTTTCAAGG + Intronic
1025284364 7:57650239-57650261 TTATGCACGTGGAGGTGACATGG - Intergenic
1026129025 7:67605377-67605399 CTCTGCAGGGGGTGATCTCAGGG - Intergenic
1026491305 7:70866292-70866314 CTCTGCAGCTTGAGGGGTGAGGG + Intergenic
1027963807 7:84980730-84980752 CTGTTCTGGTGGAGGTGGCAGGG + Intergenic
1028798907 7:94938226-94938248 CTCTGCATGTGGAGGGATCTAGG + Intronic
1029639740 7:101813585-101813607 CTCTGCAGGGGGTGGTGGGAAGG - Intergenic
1030325259 7:108212002-108212024 CTGTTCTGGTGGAGGTGGCAGGG - Intronic
1030537813 7:110790938-110790960 ATCTGTATGTGCAGGTGTCAGGG - Intronic
1030871789 7:114764790-114764812 CTCTGGAGGTGGAGGTGGGAGGG + Intergenic
1031847085 7:126818957-126818979 CTCAGAAGGTGGAAGTGACAGGG - Intronic
1031879272 7:127177603-127177625 TTGTTCAGGTGGAGGTGGCAGGG - Intronic
1032817746 7:135494392-135494414 CCCAGGAGGTGGAGGTTTCAGGG + Intronic
1032896502 7:136256869-136256891 CTCTGTAGATGGAGGTGAGAAGG + Intergenic
1033797104 7:144858919-144858941 CTCAGGAGGTGGAGGTTGCAGGG + Intergenic
1033803508 7:144928138-144928160 CCCGGGAGGCGGAGGTGTCAGGG + Intergenic
1034085465 7:148318244-148318266 CTCTGCAGGGGGCGGTTTGATGG - Intronic
1034244691 7:149635599-149635621 CTCTGCAGGTTGGGATGTCCAGG - Intergenic
1034246218 7:149646497-149646519 CTCTGGAGCTTCAGGTGTCAGGG + Intergenic
1034683144 7:152946711-152946733 CTGTTCTGGTGGAGGTGGCATGG + Intergenic
1034975644 7:155448085-155448107 CCCTGCAGGTGGAGGGGGAAAGG + Intergenic
1036075413 8:5493924-5493946 CTTTGCAGCTGGAGGTATGATGG + Intergenic
1036167126 8:6446387-6446409 CTTTGAAGGTGGAGAAGTCATGG + Intronic
1037837921 8:22225102-22225124 CACTGCACATGGAGGTCTCAGGG + Intronic
1038367153 8:26948132-26948154 CTGTTCCGGTGGAGGTGGCAAGG + Intergenic
1038911967 8:31974887-31974909 CCCTGCAGTTGGATGTCTCAGGG - Intronic
1039288638 8:36069902-36069924 CTCTGCAGGAGGAAGCATCATGG + Intergenic
1039788433 8:40854682-40854704 GCCTGCAGGTGGAGCTGGCATGG + Intronic
1039887181 8:41661550-41661572 GTCTGCAGGTGGAGCTGAGAGGG - Intronic
1040590699 8:48789749-48789771 CTCTGGATGGGGTGGTGTCAGGG + Intergenic
1041442993 8:57918580-57918602 CCCGGGAGGTGGAGGTGGCAAGG + Intergenic
1041570493 8:59332801-59332823 CTGTTCTGGTGGAGGTGGCAGGG + Intergenic
1042467076 8:69140537-69140559 CTGTTCCGGTGGAGGTGGCAGGG + Intergenic
1044705434 8:95004078-95004100 CTCCCCAGGTGGAGAAGTCAGGG - Intronic
1049139232 8:140936641-140936663 ATTTGCTGGTGGAGGTGTGAAGG - Intronic
1049326047 8:142022148-142022170 CCTTGCAGGTGGAGGGGTCAGGG - Intergenic
1049694986 8:143978928-143978950 CTCTGAAGGTTGAGGTTTCCTGG - Intronic
1050075465 9:1858114-1858136 CTCTGCTGCTGGAGGGGGCAAGG - Intergenic
1051362731 9:16295169-16295191 CTGTTCTGGTGGAGGTGGCAGGG - Intergenic
1052291168 9:26842796-26842818 CTTTGAAGGTTGAGGAGTCAGGG - Intronic
1052537189 9:29761889-29761911 CTGTTCTGGTGGAGGTGGCAGGG - Intergenic
1053280932 9:36819523-36819545 CTATGCCGGTGGAGGTGCCTGGG + Intergenic
1054830296 9:69617524-69617546 CTCTTAAGGTGGAGGTGTACAGG - Intronic
1056309504 9:85324767-85324789 CTGTTCTGGTGGAGGTGGCAGGG - Intergenic
1056662160 9:88551981-88552003 CTCAGCATGTGGAGGTGGGAGGG + Intronic
1056867083 9:90237597-90237619 CTCTGAAGGAGGAGGGGTTAGGG - Intergenic
1057556350 9:96091248-96091270 CTCTGGAGGTGAAGTTTTCATGG - Intergenic
1058396278 9:104557516-104557538 CTGCACTGGTGGAGGTGTCAGGG - Intergenic
1058553304 9:106138841-106138863 ATCGGCAGGTGGAGGACTCAAGG + Intergenic
1058568394 9:106312222-106312244 TTTTGCAGATGGAGGAGTCAAGG - Intergenic
1060107947 9:120886115-120886137 CTCTGCAGGGGGAGGCATCTGGG - Intronic
1060172399 9:121472748-121472770 CTCAGCAGGTGGGGTTGGCAAGG - Intergenic
1060183843 9:121551982-121552004 CTGGGTAGGTGGAGGTGGCAGGG + Intergenic
1061252662 9:129435902-129435924 CTGGGCAGGTGCAGGTTTCAGGG + Intergenic
1062008272 9:134252649-134252671 CCTGGCAGGAGGAGGTGTCACGG + Intergenic
1186364536 X:8877431-8877453 CTCTGCAGGAGGCAGTGACAAGG + Intergenic
1186406793 X:9311615-9311637 CTCTGCAGCTGGAGGTGGGCTGG - Intergenic
1187224131 X:17359607-17359629 CTCTGCTGGAGGGGGTGTCTGGG - Intergenic
1187568299 X:20474826-20474848 CTGAGCAGGTGCTGGTGTCATGG + Intergenic
1187773553 X:22730228-22730250 CTGTTCTGGTGGAGGTGGCAGGG + Intergenic
1191080409 X:56504588-56504610 CTGTTCTGGTGGAGGTGGCAGGG - Intergenic
1191080696 X:56506372-56506394 CTGTTCTGGTGGAGGTGGCAGGG - Intergenic
1191871143 X:65746601-65746623 ATATGCAGGTAGAGGTTTCAAGG - Intergenic
1191954179 X:66625768-66625790 CTGTTCCGGTGGAGGTGTCAAGG - Intronic
1192474338 X:71426637-71426659 CCCTGGAGGTGGAGGTTGCAGGG + Intronic
1192929629 X:75792165-75792187 CTGTCCTGGTGGAGGTGGCAGGG - Intergenic
1193423713 X:81315859-81315881 CTATTCCGGTGGAGGTGACAGGG + Intergenic
1193785958 X:85760219-85760241 CTGTTCTGGTGGAGGTGGCAAGG + Intergenic
1193937678 X:87642145-87642167 CTCTTCCAGTGGAGGTGGCAGGG - Intronic
1194701439 X:97119439-97119461 CTGTTCTGGTGGAGGTGGCAGGG + Intronic
1195474960 X:105275133-105275155 CTCGGGAGGTGGAGGTTACAGGG + Intronic
1195795511 X:108642491-108642513 CTCTTCCAGTGGAGGTGGCAGGG - Intronic
1197472121 X:126877075-126877097 CTGCTCTGGTGGAGGTGTCAAGG + Intergenic
1197518962 X:127473430-127473452 CTGTTCTGGTGGAGGTGACAGGG - Intergenic
1197664559 X:129210129-129210151 CTGTTCTGGTAGAGGTGTCAGGG + Intergenic
1199603365 X:149556812-149556834 CTCTGCAGGTGCAGCTCCCATGG - Intergenic
1199647022 X:149922663-149922685 CTCTGCAGGTGCAGCTCCCATGG + Intergenic
1200691311 Y:6307877-6307899 CCCTGCAGGGAGAGGAGTCAGGG - Intergenic
1201043961 Y:9866839-9866861 CCCTGCAGGGAGAGGAGTCAGGG + Intergenic
1201063518 Y:10068999-10069021 CTCTGCAGGAGGAGGCGTCCGGG - Intergenic
1202378827 Y:24259571-24259593 CTCAGCATGTGAAGGTGGCAGGG + Intergenic
1202491955 Y:25410550-25410572 CTCAGCATGTGAAGGTGGCAGGG - Intergenic