ID: 1081227471

View in Genome Browser
Species Human (GRCh38)
Location 11:40541882-40541904
Sequence TCAGTTCTGTTTATAGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 199}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081227471 Original CRISPR TCAGTTCTGTTTATAGAAGG AGG (reversed) Intronic
904837476 1:33348841-33348863 TCAGTTCAGGTTATGGAAGACGG + Intronic
908113985 1:60923554-60923576 TGATTTCTGTTTACAGAAAGAGG - Intronic
908911037 1:69072391-69072413 TCAGTTCTGATGATAGAACCAGG + Intergenic
910619460 1:89236631-89236653 TCAGTCCTGATGATAGAAGCTGG + Intergenic
910708479 1:90154844-90154866 TCAGCTCTGTTTTTATAGGGAGG + Intergenic
911201634 1:95050505-95050527 TTAAAACTGTTTATAGAAGGAGG - Intronic
912444054 1:109720865-109720887 TCTATTCTGTTAATAGAAGGGGG - Intronic
912585577 1:110761940-110761962 ATAGTTCTGTTTATTGTAGGTGG + Intergenic
913520667 1:119642831-119642853 TGATTTCTGATAATAGAAGGTGG - Intronic
913590931 1:120323974-120323996 TCAGTTCTGTTTTGTGAAGACGG - Intergenic
914168670 1:145197921-145197943 TCAGTTCTGTTTTGTGAAGGCGG - Intergenic
914523792 1:148441880-148441902 TCAGTTCTGTTTTGTGAAGACGG - Intergenic
914599882 1:149193968-149193990 TCAGTTCTGTTTTGTGAAGACGG + Intergenic
914642613 1:149625260-149625282 TCAGTTCTGTTTTGTGAAGACGG + Intergenic
915059224 1:153166288-153166310 TTAGTTCTGATTATAGTAGAGGG + Intergenic
916535212 1:165697717-165697739 TCAGTCCTGGTTTTAAAAGGGGG + Intronic
917049014 1:170897266-170897288 TCAGTTTTGTTTATAGGCAGTGG - Intergenic
917822789 1:178782340-178782362 TCACTTCTGCTTCTAGCAGGAGG + Intronic
918777774 1:188657483-188657505 TCACATCTGTTTCTAGAATGAGG + Intergenic
1063983885 10:11480403-11480425 TGACCTCTTTTTATAGAAGGAGG + Intronic
1065662193 10:28017409-28017431 TCAGTTCTAAATATAGAAAGTGG - Intergenic
1067160783 10:43823153-43823175 TCAGCACTGTGTATAGAAGTTGG + Intergenic
1067880417 10:50039228-50039250 GCAGTTCTTTTTAAAGATGGTGG + Intergenic
1068049208 10:51927716-51927738 TCAGTCCTAGTAATAGAAGGAGG - Intronic
1070573249 10:77657613-77657635 TCAGTTGTGATTATAGAAGAAGG + Intergenic
1070601421 10:77868943-77868965 CCAGTTCTGATGTTAGAAGGAGG - Intronic
1072823357 10:98580740-98580762 TCAGCTCAGTTTATAGAAGTAGG - Intronic
1074107768 10:110401416-110401438 TCAGTTTTGTTTTGAGATGGGGG - Intergenic
1075965485 10:126608047-126608069 TCAGTTCTGAGGATAGATGGTGG + Intronic
1077661482 11:4072294-4072316 GCAGGTCTGTTAATACAAGGAGG - Intronic
1078798085 11:14613742-14613764 TCAGTTCTTTTTAAGTAAGGTGG + Intronic
1081227471 11:40541882-40541904 TCAGTTCTGTTTATAGAAGGAGG - Intronic
1081455767 11:43221084-43221106 TCCTTTCTGTTTATAATAGGGGG + Intergenic
1081496431 11:43615709-43615731 TTATATGTGTTTATAGAAGGAGG + Intronic
1084198326 11:67539083-67539105 TCAGTCCTGTTCACAGGAGGTGG + Intergenic
1085715514 11:78869713-78869735 TCAGATCTGTTTTTAGATCGGGG - Intronic
1086974963 11:93121053-93121075 TCAGTTCTGCTCATAGAAAAAGG + Intergenic
1088335547 11:108699670-108699692 TCAGTTCTGTTCCTTGTAGGGGG + Intronic
1090257325 11:125294427-125294449 TCAGTACTGAGTAGAGAAGGTGG + Intronic
1091383143 12:75948-75970 TCGGTTCTGTTTATTGCCGGGGG - Intronic
1091401480 12:183382-183404 TAAGATCTGTGTATAGATGGGGG - Intergenic
1095433319 12:42158095-42158117 TCAGTTCTGTTTATGGAATTTGG + Exonic
1096702889 12:53398096-53398118 TGACTTCTGCTTATAGAAGTAGG + Intronic
1097641633 12:62190743-62190765 TCAGGCCTGTTTGCAGAAGGTGG - Intronic
1097748852 12:63330418-63330440 TCAGTTCTGATAAGAGAAGCTGG - Intergenic
1098035402 12:66296712-66296734 TCTGTTTTGTTTATAAAAGTGGG - Intergenic
1099581943 12:84460050-84460072 GCAGTTCTATTCATAGAAGCCGG + Intergenic
1099896843 12:88659065-88659087 TCATATCTATTTTTAGAAGGAGG - Intergenic
1102313512 12:111866496-111866518 TCAGTTTTGCTTATTGAAGAAGG + Intronic
1103705604 12:122870136-122870158 TCTATGCTGTTTAGAGAAGGTGG + Intronic
1106526295 13:30543836-30543858 TCAGTTCGTTTTATAGAGGCTGG - Intronic
1108447924 13:50527850-50527872 ACACATCTGTTTATAGGAGGAGG + Intronic
1108563229 13:51667549-51667571 GCAGTTCTGCTTTTATAAGGTGG + Intronic
1108661856 13:52595149-52595171 TCAGTTCTGTCTGCAGTAGGAGG - Intergenic
1109666662 13:65548829-65548851 CCAGCTCTGTTTATAGAATAGGG + Intergenic
1110027820 13:70564530-70564552 ACAGTTCTGTATATCGAATGTGG - Intergenic
1112971238 13:105265788-105265810 ACATTTCTGGTGATAGAAGGTGG + Intergenic
1115235508 14:31206362-31206384 TCAGTTTTGGGTAGAGAAGGAGG - Intronic
1116143900 14:41038245-41038267 TCAGTTATGTTTATAGCACTTGG + Intergenic
1117378929 14:55140676-55140698 TCAGTTTTGTCTATAAAAAGGGG - Intronic
1118759196 14:68868874-68868896 CCAGCTCTGTATACAGAAGGAGG - Intergenic
1121098731 14:91235111-91235133 GCCATCCTGTTTATAGAAGGTGG + Exonic
1121103592 14:91265939-91265961 TCCTTTCTTTTTGTAGAAGGGGG - Intergenic
1121732333 14:96195245-96195267 TCAGGTCTGTTTTCTGAAGGTGG - Intergenic
1122918929 14:104871633-104871655 CCAGTCCTGTGTAAAGAAGGTGG + Intronic
1125350910 15:38766708-38766730 TCAGATCTGTGTTTAGAAGCTGG + Intergenic
1126263955 15:46729954-46729976 TCTGGTCTGTTTATAGTTGGTGG + Intergenic
1126393906 15:48191440-48191462 TCAGTTCTGCTAAAAGAAAGAGG - Intergenic
1127201212 15:56653522-56653544 TCAGTTGTGTCCATCGAAGGGGG + Intronic
1127882011 15:63166568-63166590 TATGTTCTGTATATTGAAGGGGG - Intergenic
1131314538 15:91322288-91322310 TAAGTTCTGTTTATTAAAGAAGG - Intergenic
1131514370 15:93067438-93067460 CCAGTTCTGTTTATAAAAGCAGG - Intronic
1138673066 16:58630641-58630663 TTAGTTCTGTCTATTGAAGAAGG + Intergenic
1138906210 16:61338003-61338025 TCAGTGCCGTTTATTGAATGGGG - Intergenic
1139815771 16:69669870-69669892 TGAGTTGTCTTTATTGAAGGAGG - Intronic
1141296735 16:82776731-82776753 TCAGTTCTGCTTTTCCAAGGTGG - Intronic
1144256642 17:13475002-13475024 TCATTTCTATTTATAAAATGGGG - Intergenic
1144486826 17:15673409-15673431 TCTCTTCTGTTTAAAGAAGTCGG - Intronic
1144914196 17:18708886-18708908 TCTCTTCTGTTTAAAGAAGTCGG + Intronic
1145848403 17:28065561-28065583 TCAGATTTATTTTTAGAAGGTGG + Intronic
1150162435 17:62909927-62909949 TCTCTTCTGTGTATAGATGGTGG - Intergenic
1151011773 17:70506784-70506806 TCAGTAATGTTTATAGAAGTGGG + Intergenic
1153067613 18:1063792-1063814 TCACTTCTCTGTATAGAGGGAGG + Intergenic
1153367682 18:4276313-4276335 GAATTTCTGTTTATAGATGGAGG + Intronic
1155203972 18:23541459-23541481 TCACTTCTGTTTACAGCCGGGGG + Intronic
1155514763 18:26613452-26613474 TCAGTTCTTTTCAAGGAAGGAGG + Intronic
1156361065 18:36385088-36385110 CCAGTTCTGGTTATGGAAGATGG - Intronic
1157373579 18:47141486-47141508 ACACTCCTGTTTTTAGAAGGTGG - Intronic
1158068504 18:53441981-53442003 TCAGTTCTGTTTAAAGGAATAGG + Intronic
1161937605 19:7381758-7381780 TCAGTTCTGGTGATAGGATGGGG + Intronic
1162117373 19:8439026-8439048 TCAGTTATGTTTCTCAAAGGAGG + Intronic
1163171636 19:15535525-15535547 TCTGTTCAGTATATAGAAGGAGG + Intronic
1166961454 19:46498608-46498630 TCTTTTCTATTTATTGAAGGTGG - Intronic
924975422 2:169735-169757 TCAATTCTGCTTTTAGAAAGGGG + Intergenic
926117194 2:10220999-10221021 TCAGTTCTGTGGACAGATGGTGG + Intergenic
927421643 2:22939295-22939317 TTTGTTCTTTTTATAGAAGTGGG - Intergenic
928054808 2:28042213-28042235 TTAGTTTTGTTTATAGGAGTTGG + Intronic
928242261 2:29596796-29596818 TCAGTTCTTCTTATAGAAGTAGG - Intronic
928377550 2:30787886-30787908 TCAGATCTGTACATAGAATGGGG + Intronic
929717367 2:44326675-44326697 TCTCTACTGTTTATAGAATGGGG - Intronic
930267723 2:49219380-49219402 TGAGTTCTGTTAATATAATGGGG + Intergenic
930923365 2:56784992-56785014 TAAATTTTGTTTATAGAATGTGG - Intergenic
934607041 2:95703750-95703772 TCAGTTGTGTTTATATGAAGTGG + Intergenic
935016318 2:99185803-99185825 TCAGTTCTAATTATAGGAGTTGG + Intronic
935139439 2:100339671-100339693 CCGGTTCTGTTTATAGAAAACGG + Intergenic
936540438 2:113345906-113345928 TCAGTTGTGTTTATATTAAGTGG + Intergenic
938587533 2:132706339-132706361 TCAGTTCTGCTGATGGAAGGAGG + Intronic
939269620 2:139921014-139921036 TCAGTTGTGTTTAAAGCAGTAGG + Intergenic
939895382 2:147785180-147785202 TTTGTTCTGTGTATAGGAGGAGG - Intergenic
940069246 2:149666337-149666359 TTAGATGTGTTTATAGAGGGTGG + Intergenic
940910921 2:159209445-159209467 TTAGTCCTATTTCTAGAAGGTGG + Intronic
941269201 2:163404168-163404190 TCTGTTCTGTTTATAGGATGAGG - Intergenic
941333594 2:164211259-164211281 TCAGTTCTGTGCACAGAAGTGGG - Intergenic
942568500 2:177289979-177290001 TCAGTTTTGTTTTTTGAAGGAGG - Intronic
942570230 2:177306709-177306731 TCACTTCAGTTTTTGGAAGGAGG - Intronic
944098941 2:196001212-196001234 CCATTTCTGTTTCTGGAAGGAGG - Intronic
945250918 2:207766319-207766341 TTAGCTTTGTTTATAGAGGGAGG - Exonic
945609360 2:211979187-211979209 TGAGTTATGTTTATACAAAGGGG + Intronic
946157201 2:217814804-217814826 TCAGTCCTCTTTGTAGCAGGGGG - Intronic
947948871 2:234130352-234130374 ACAGTTCTGTTGAGACAAGGTGG - Intergenic
1169427190 20:5505563-5505585 TCATTTCTGCTTATATAAGTAGG + Intergenic
1171037389 20:21726672-21726694 TCACTTGTGTTTGTAGAAGGTGG + Intergenic
1173238588 20:41271742-41271764 TCTGTTTTGTTTTTCGAAGGAGG - Intronic
1175583427 20:60118355-60118377 TCTGTTCTGTTCTTTGAAGGGGG - Intergenic
1176282039 20:64318811-64318833 TCGGTTCTGTTTATTGCCGGGGG + Intergenic
1177511471 21:22092337-22092359 TCAGTTCTGATGAGAGAAGCTGG + Intergenic
950352369 3:12368741-12368763 TGAGTTTTGTTTAGTGAAGGAGG - Intronic
950560567 3:13719188-13719210 TACCTTCTGTTTACAGAAGGTGG - Intergenic
950681343 3:14587170-14587192 TCAGTTCTGTATGGAGAAGGAGG + Intergenic
951603675 3:24407053-24407075 TCAGTTCAGTTTATCTAAAGTGG - Intronic
951826497 3:26874878-26874900 TTAGTTCTGTTTATTTAAAGGGG + Intergenic
956037407 3:65109592-65109614 TCACTTCTGTTTATAGTATATGG + Intergenic
956459361 3:69455278-69455300 TCAGGTCTGTTTACATAATGTGG + Intronic
957901282 3:86495958-86495980 TCAGTTCTCTTTATAAAACAAGG + Intergenic
961675304 3:128561285-128561307 ACAGTTCTGTGGATAGATGGTGG + Intergenic
963608062 3:147430408-147430430 TCAGATCTGGTTATAAAATGGGG - Intronic
963811735 3:149784235-149784257 ACAAGTCTGGTTATAGAAGGAGG + Intronic
966697300 3:182803721-182803743 TCAATGCTGTTTATTGAATGAGG + Intronic
966731874 3:183158423-183158445 TATGTTCTGTGTATAGAGGGAGG - Intronic
967066188 3:185918432-185918454 TGACATTTGTTTATAGAAGGCGG - Exonic
967257775 3:187610937-187610959 TCAATTCTGTTTAGGGAATGAGG + Intergenic
972721315 4:41701769-41701791 ACAGTTCTGTCTAAAGAAAGAGG + Intergenic
972880150 4:43412920-43412942 TCAGCATTGTTTATTGAAGGGGG - Intergenic
973113126 4:46419968-46419990 TATGTTGTTTTTATAGAAGGAGG - Intronic
974521265 4:62983672-62983694 TCAGGGCTGTATATAGAAAGAGG - Intergenic
976126394 4:81837784-81837806 TCAGTTCTTTTGAAAGTAGGTGG - Intronic
976571288 4:86614241-86614263 TTTGTTCTGTTTATAAATGGGGG - Intronic
976913341 4:90337117-90337139 TCAATTATGTTTGTAAAAGGTGG + Intronic
977669404 4:99678525-99678547 TCAGCTCTGTTCAGACAAGGGGG - Intergenic
978616648 4:110603568-110603590 ACAGTTCTGTTTCCAGAAAGGGG + Intergenic
978728590 4:111999229-111999251 TCATATCTGTTTTTTGAAGGAGG + Intergenic
978862058 4:113461869-113461891 GCAGTACTGTTTATAGAACGTGG + Intronic
982274636 4:153626778-153626800 TTATTTCTGAATATAGAAGGAGG + Intronic
986157871 5:5194910-5194932 TCAGTTCTGTTTACATTCGGAGG + Intronic
987812153 5:22851556-22851578 TCAGTAGTTTTCATAGAAGGTGG + Intronic
988729732 5:33959721-33959743 GCAGTCATGTTTATAGAATGAGG + Intronic
989731049 5:44649304-44649326 CCAGTACTATTTATAAAAGGGGG - Intergenic
990620222 5:57550739-57550761 TCAGTTCTGATGATAGAACCTGG + Intergenic
991022200 5:61991427-61991449 TCTGTTCTGTTTATTCAAGCTGG - Intergenic
992328415 5:75687338-75687360 ACAGTTGTTTTAATAGAAGGGGG + Intronic
992788534 5:80192819-80192841 TCAGCTCTGTCTCTAGAATGGGG + Intronic
993692628 5:91021457-91021479 TCAGTTTTATTTATATTAGGTGG + Intronic
994686582 5:102961771-102961793 CCTGTTCTGTTTATTGAAAGTGG + Intronic
995862462 5:116655896-116655918 TCATTTCTGTTTTGAAAAGGCGG - Intergenic
995947501 5:117666615-117666637 TCAGTTTTCTTTATAAAATGTGG + Intergenic
995955351 5:117770067-117770089 TCAGCTGTGGTTATAAAAGGAGG - Intergenic
998801443 5:145873610-145873632 CCAGTTCTGGTTCTAGAAGAGGG + Intergenic
1006048942 6:31325268-31325290 TTAGTTCTGTTTGTATAACGAGG - Intronic
1007308727 6:40927788-40927810 TCAATTCTGTTTTTCGAATGAGG - Intergenic
1008845700 6:55960849-55960871 TGAGTTCTGTTTATTGAAAAAGG - Intergenic
1009785420 6:68331700-68331722 GAAGTTCTGTTACTAGAAGGGGG - Intergenic
1010815057 6:80348409-80348431 GCAGTGCTGTTTCTAGAAGTTGG - Intergenic
1016047611 6:139496743-139496765 TCAGTTCTGGTTATTAAGGGTGG - Intergenic
1016410889 6:143783202-143783224 TCTTTTCTGTTTATTAAAGGAGG - Exonic
1017586438 6:155930542-155930564 GCAGTTCTATTTCTATAAGGAGG - Intergenic
1017697583 6:157032823-157032845 TCAGTTTTTTTTAAAAAAGGTGG - Intronic
1019749017 7:2717219-2717241 TTTGTTTTGTTTATAAAAGGAGG + Intronic
1022056168 7:26736701-26736723 TCATTTCTGTTACTGGAAGGGGG - Intronic
1023202504 7:37713901-37713923 TCAGTTTTGTTTACATAATGGGG - Intronic
1024932828 7:54681666-54681688 ACAGTGCTGTTTATTGAAGGTGG + Intergenic
1025214992 7:57048974-57048996 TCAGGTCTCTTTGTAGAGGGAGG - Intergenic
1026094317 7:67330658-67330680 TCAGATCTGTTTTCAGAAAGAGG - Intergenic
1027727253 7:81823053-81823075 TCAGTTCTGCTTAAAGAATATGG - Intergenic
1027967587 7:85032748-85032770 ACAGTTGTGGTTAAAGAAGGAGG - Intronic
1028391556 7:90322234-90322256 TCAGTTCTGTTTTGTGCAGGAGG - Intergenic
1028796054 7:94906088-94906110 TGAGTTCTGTCTGTAGAAGAGGG - Intergenic
1029027627 7:97433972-97433994 TGAGTTCTGTCTAGAGAAGAGGG + Intergenic
1029569779 7:101361953-101361975 GCTTTTCTGTTTATAAAAGGTGG + Intergenic
1031821084 7:126502355-126502377 TAAGATCTGTTTACAGGAGGAGG + Intronic
1033190647 7:139275655-139275677 TCTTTTCTGTTGATAGAAGATGG - Intronic
1034836176 7:154353187-154353209 GAAGTTCTGTTTAAAGAAGCAGG + Intronic
1040574684 8:48641418-48641440 TGAGTGCTGTATATACAAGGGGG - Intergenic
1041885206 8:62800470-62800492 TCAGATCTATTTCTAAAAGGAGG + Intronic
1043262022 8:78213146-78213168 TTAGTTATCTTTTTAGAAGGTGG + Intergenic
1043541856 8:81272731-81272753 TCTTTCCTGTTTATAGAAGCTGG + Intergenic
1043727941 8:83635273-83635295 TCATTCCTGTTTATAGGATGAGG + Intergenic
1050125355 9:2351771-2351793 TCAGATTTGTTTATAGTAGAGGG - Intergenic
1050758814 9:9040906-9040928 CCAGTTCTGTTTCTAAAAGCTGG - Intronic
1052598210 9:30589772-30589794 TCTGTTATGTTTATTGGAGGAGG - Intergenic
1052854007 9:33395686-33395708 TCAGTGCTGTTTATAGAGCTCGG - Intronic
1055302643 9:74898324-74898346 TCAGGTCTGGTTCAAGAAGGAGG + Intergenic
1056184827 9:84123871-84123893 TCAGCTTCGTTTATAAAAGGTGG + Intergenic
1056290675 9:85140775-85140797 TTAATTCTATTTATAGAAGGTGG - Intergenic
1059450220 9:114366976-114366998 TCACTTCTGTTTTCAGAATGTGG + Intronic
1059923258 9:119181015-119181037 ACAGTTCTGTGTCTGGAAGGAGG + Intronic
1059987321 9:119833403-119833425 TCAGTTCTGCAGATAAAAGGTGG - Intergenic
1060169067 9:121445906-121445928 GCAGTTCTGTTTCTAGGATGTGG - Intergenic
1189096306 X:38143856-38143878 TCAGTTCTGGTCATGGTAGGGGG + Intronic
1189506498 X:41616355-41616377 TCAGTTCCCTATCTAGAAGGTGG - Intronic
1190637444 X:52450109-52450131 TCAGTTTTATTTATAAAATGAGG + Intergenic
1190648586 X:52546159-52546181 TCAGTTTTATTTATAAAATGAGG - Intergenic
1192442914 X:71188130-71188152 TCATTTCTGTTTATAAAAGTCGG - Intergenic
1193515901 X:82463120-82463142 TCATTCCTATTTATACAAGGAGG + Intergenic
1194437127 X:93880782-93880804 TTAATTTTGTTTATAGTAGGAGG - Intergenic
1195147083 X:102028845-102028867 TCAGTTCTGTTGAGAGAACCTGG - Intergenic
1196207603 X:112958463-112958485 TCTGTTCTCTCTACAGAAGGAGG - Intergenic
1197332652 X:125173147-125173169 TCATGTCTGTTTATAAAATGTGG - Intergenic
1198400160 X:136261070-136261092 TTCAGTCTGTTTATAGAAGGAGG + Intergenic
1198560739 X:137847612-137847634 ACAATTCTGATTATAGAAGGAGG - Intergenic