ID: 1081227751

View in Genome Browser
Species Human (GRCh38)
Location 11:40545632-40545654
Sequence GCACATATTAAGTATAAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 247}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081227748_1081227751 7 Left 1081227748 11:40545602-40545624 CCCCTCTATTGCTGTGTTAGATA 0: 1
1: 0
2: 0
3: 7
4: 133
Right 1081227751 11:40545632-40545654 GCACATATTAAGTATAAACAAGG 0: 1
1: 0
2: 0
3: 32
4: 247
1081227750_1081227751 5 Left 1081227750 11:40545604-40545626 CCTCTATTGCTGTGTTAGATAAG 0: 1
1: 0
2: 0
3: 5
4: 113
Right 1081227751 11:40545632-40545654 GCACATATTAAGTATAAACAAGG 0: 1
1: 0
2: 0
3: 32
4: 247
1081227749_1081227751 6 Left 1081227749 11:40545603-40545625 CCCTCTATTGCTGTGTTAGATAA 0: 1
1: 0
2: 1
3: 10
4: 199
Right 1081227751 11:40545632-40545654 GCACATATTAAGTATAAACAAGG 0: 1
1: 0
2: 0
3: 32
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081227751 Original CRISPR GCACATATTAAGTATAAACA AGG Intronic
902641242 1:17767657-17767679 GCACCTATGGAGGATAAACATGG - Intronic
905736869 1:40335009-40335031 GTACATATTTAGTACAAAGAAGG - Intergenic
906786708 1:48622358-48622380 GCACATGTTAATGATAGACAAGG - Intronic
907735164 1:57105051-57105073 GCACAGATGAAGGAAAAACAGGG + Intronic
908217508 1:61969373-61969395 GCAAATAATAAGTGTAGACAAGG - Intronic
909873079 1:80768247-80768269 GGACATTTTAAGAATTAACAAGG - Intergenic
910248985 1:85173869-85173891 GAACATATTAAGTAGAGACATGG + Intronic
910494550 1:87812059-87812081 GCTCATATTAAGAATAATCATGG - Intergenic
910836129 1:91513272-91513294 GCACAAATTCAGATTAAACAAGG + Exonic
911366033 1:96938492-96938514 GCATTTATTAAGTATCTACATGG + Intergenic
911508353 1:98782438-98782460 TCAAATATTAAGTATAGAAATGG + Intergenic
911625362 1:100117817-100117839 GCAAATATTAAGAATTAAGAAGG + Intronic
912224245 1:107714613-107714635 GAACAAATTATGAATAAACAAGG - Intronic
913349001 1:117837389-117837411 GAAGAAATTAACTATAAACACGG + Intergenic
916998309 1:170326335-170326357 GAACATATGAAGAATAATCAGGG - Intergenic
919043335 1:192420780-192420802 ACATATAATAAATATAAACAAGG + Intergenic
919677836 1:200403725-200403747 AAAGATATTAAGTATAAGCATGG - Intergenic
921986951 1:221322575-221322597 GCCCATATTTAGTATAAAAATGG - Intergenic
922916105 1:229259016-229259038 GCACACAGTAAGGATAACCATGG - Intergenic
1062800211 10:373254-373276 GCACATTCTTAGTATGAACAAGG + Intronic
1065035374 10:21633235-21633257 GCACATATTAACTGAAAACCTGG + Intronic
1068568421 10:58601489-58601511 ACACATAATAAGCAAAAACAAGG - Intronic
1068597212 10:58915828-58915850 GCACAACTTAAGTATAAATTGGG + Intergenic
1069328653 10:67263511-67263533 GCACCTATTCATTATAAAAAAGG + Intronic
1070217294 10:74399196-74399218 ACACATATTAAATAAAAACAAGG - Intronic
1073568681 10:104557515-104557537 GAACAAATTGAATATAAACATGG + Intergenic
1074518333 10:114193214-114193236 CCACATATTAATAATGAACATGG - Intronic
1074842308 10:117367236-117367258 TCACATATTTAGTACAGACAGGG - Intronic
1075571568 10:123550268-123550290 GCTCATCTTCAGTAAAAACATGG + Intergenic
1078620445 11:12902454-12902476 GCACAAATGAAGTATACACTGGG - Intronic
1079371063 11:19853065-19853087 TCACATATAAAGTTTGAACACGG - Intronic
1079922414 11:26449162-26449184 GCACATATTTATTGTGAACAAGG - Intronic
1081227751 11:40545632-40545654 GCACATATTAAGTATAAACAAGG + Intronic
1081331792 11:41810407-41810429 ACAGATATAAAGTTTAAACAAGG + Intergenic
1081506301 11:43720732-43720754 GCACCTAGTAAGTTTAAACTTGG + Intronic
1082127936 11:48454558-48454580 TCATATATTTAGTAGAAACAGGG + Intergenic
1082720189 11:56664859-56664881 TCACATATTAATTAGAAACTGGG + Intergenic
1085579202 11:77635842-77635864 GCATATATTGAGTATTGACAAGG - Intronic
1088787041 11:113191335-113191357 GGATATACTAAGTTTAAACAGGG - Intronic
1091087222 11:132733395-132733417 GCACATAATATTTAGAAACAGGG + Intronic
1092508241 12:9126031-9126053 GAACTTATAAAATATAAACATGG - Intergenic
1093151095 12:15622556-15622578 GCACATTTTAAGTCTAAAATAGG + Intronic
1093399695 12:18730463-18730485 GCATAAATTACATATAAACAAGG - Intronic
1094049255 12:26200949-26200971 TCTCATAGTAAGTATAAAAATGG + Intronic
1094063097 12:26335286-26335308 GCAGATATTACTTAGAAACATGG + Intergenic
1095880827 12:47134461-47134483 GAAAATATTAACTTTAAACAGGG + Intronic
1096312804 12:50536250-50536272 GCACGTATTTAGTAGAAATAAGG - Intronic
1097769253 12:63562142-63562164 GCACATATTTAGTATCCACTTGG + Intronic
1098535072 12:71584723-71584745 TCACATATTAATTAGAGACATGG - Exonic
1099367543 12:81787124-81787146 ACACATATTAAGAATAAAGATGG - Intergenic
1099514487 12:83580377-83580399 TAAAATATAAAGTATAAACATGG + Intergenic
1101756239 12:107622644-107622666 GCTAATATTTAGTAGAAACAAGG + Intronic
1103841157 12:123866198-123866220 GCACAAAATAAGTGAAAACATGG + Intronic
1107062471 13:36174405-36174427 GTACATATTTAGCATCAACATGG + Intronic
1108479558 13:50854731-50854753 ACACCTCTTAAGTCTAAACATGG - Intergenic
1109812134 13:67526693-67526715 GCACATATTAATGCCAAACATGG - Intergenic
1110068295 13:71138412-71138434 GCACATATTAAGTCTTACAAGGG - Intergenic
1110470318 13:75852985-75853007 CCACATATAAAATATAAAAATGG + Intronic
1111060322 13:83010146-83010168 CCACATATTAATAATAAACCAGG + Intergenic
1111280006 13:86010166-86010188 ACCCATATTTAGTATAAAAATGG + Intergenic
1111289134 13:86140444-86140466 GCACATGTAAAATGTAAACATGG - Intergenic
1111425777 13:88079822-88079844 TTTCATATTAAGTATAAACTAGG + Intergenic
1111985659 13:95064195-95064217 CCACCTATAAAGTATAAACTAGG - Intronic
1112080490 13:95964565-95964587 GCTAATATTAAGAATATACAAGG + Intronic
1113998766 14:16123626-16123648 TCACATAAAAAGTATAAAGAAGG - Intergenic
1113998775 14:16123797-16123819 TCACATAAAAACTATAAACAAGG - Intergenic
1113998829 14:16124654-16124676 TCACTTAAAAAGTATAAACAAGG - Intergenic
1114703416 14:24702022-24702044 GCACATATGACTTGTAAACATGG + Intergenic
1116352194 14:43876782-43876804 ACACATCTTAAGTTTATACATGG + Intergenic
1116551989 14:46252177-46252199 ACTCATATTAAATAGAAACATGG - Intergenic
1116838584 14:49796023-49796045 GCACATATACAGTATATAAATGG + Intronic
1118183099 14:63513138-63513160 CCACATGTCAAGTATAAACTAGG - Intronic
1119975108 14:79016481-79016503 GCACACTTTGAGTATAAACTAGG - Intronic
1120080890 14:80215051-80215073 GAACATATGAAATCTAAACAAGG - Intronic
1120712800 14:87810218-87810240 GCCCATATTTAGTAGAAAAATGG - Intergenic
1121585308 14:95059276-95059298 GCCCATATTTAGTATAAAAATGG - Intergenic
1202918450 14_KI270723v1_random:6578-6600 GCAAATGTTAAGTGTAGACAGGG + Intergenic
1202926173 14_KI270724v1_random:27992-28014 GCAAATGTTAAGTGTAGACAGGG - Intergenic
1123227878 15:17064443-17064465 TCACATAAAAAGTATAAACAAGG + Intergenic
1124030942 15:26011293-26011315 ATACATATTAGGAATAAACATGG - Intergenic
1125404327 15:39337046-39337068 GCTACTTTTAAGTATAAACATGG + Intergenic
1126249260 15:46548606-46548628 CCACATAAAAAGTATAAAGAAGG - Intergenic
1126923796 15:53558943-53558965 GCACATTTTAAGTATGCACCTGG - Intronic
1127128176 15:55834078-55834100 GAACATACAAAGTATAAAAATGG - Exonic
1128620302 15:69143457-69143479 GCTCAAATTAAGTATAAAAGTGG + Intergenic
1128807591 15:70543113-70543135 ACACATATTCAGTGTAACCAAGG + Intergenic
1129380178 15:75160009-75160031 GCATTTATTAAATAAAAACATGG - Intergenic
1129615053 15:77091970-77091992 GCAGATATTATGGATAAAAATGG - Intergenic
1133315629 16:4882066-4882088 CCACAAATAAAGCATAAACAAGG - Exonic
1134895559 16:17883453-17883475 GGATATATTAAGTAAAAATAAGG + Intergenic
1136907534 16:34113679-34113701 TCACATAAAAAGTATAAAGAAGG + Intergenic
1136915180 16:34183853-34183875 TCACATAAAAAGTATAAAGAAGG - Intergenic
1136915219 16:34184537-34184559 TCACATAAAAAGTATAAACAAGG - Intergenic
1136940230 16:34517483-34517505 GCCCAAATTAAAAATAAACAGGG - Intergenic
1136955861 16:34785327-34785349 GCCCAAATTAAAAATAAACAGGG + Intergenic
1136959590 16:34831083-34831105 GCCCAAATTAAAAATAAACAGGG + Intergenic
1140323468 16:73977057-73977079 GTACATATTAAAAATAGACATGG - Intergenic
1141791714 16:86241301-86241323 GCAAATATTTGGAATAAACAAGG + Intergenic
1142844433 17:2661707-2661729 GCTCATATGAAGAAAAAACAAGG - Intronic
1145215983 17:21052893-21052915 GAACATGTTCAGTAGAAACATGG + Intergenic
1147796721 17:43048925-43048947 GCACATATTAAATATACTGAGGG - Intronic
1148516865 17:48227253-48227275 GCACAGAACAAGAATAAACAGGG - Intronic
1150449902 17:65258079-65258101 ACACCTAGTAAGTATTAACATGG + Intergenic
1150513080 17:65776531-65776553 TCACATACTAACTATAAAAAGGG - Intronic
1152313422 17:79565072-79565094 TGTCATATTAAGTAAAAACAGGG + Intergenic
1153211916 18:2776509-2776531 GTACATATAAAATATAAAAAAGG - Intronic
1158510542 18:58086616-58086638 ATACATTTTAAGTACAAACAAGG + Intronic
1158809978 18:61021048-61021070 GCCCATATTTAGTATAAAAATGG - Intergenic
1159191373 18:65047747-65047769 GGATATATGAAGTATAAACTTGG - Intergenic
1159855321 18:73580570-73580592 GCACATCCTAAGTATAACCTTGG - Intergenic
1160599601 18:80002637-80002659 GCCCATATTTAGTATGAAAATGG + Intronic
1165458538 19:35929836-35929858 GCAAATATAAAATATACACAGGG - Intergenic
1165604269 19:37086829-37086851 GCACATTTTAAATATAAAGATGG - Intronic
1167255367 19:48424624-48424646 ACACGTAATCAGTATAAACATGG + Intronic
1168530355 19:57122984-57123006 GGACACATTAATTATAATCATGG + Intronic
1168581776 19:57560696-57560718 GCCCACATTTAGTATAAAAATGG - Intergenic
924987163 2:282413-282435 ACACATAGTAAGTATAAAATTGG + Intronic
925689115 2:6503107-6503129 GCAAATATGAAGGATGAACAAGG + Intergenic
926016504 2:9457605-9457627 GCACCTATTAAGTTTAAAGAAGG + Intronic
928701919 2:33907235-33907257 ACAGTTATTAATTATAAACACGG - Intergenic
929062429 2:37936772-37936794 GCTAATATTAAGTATCTACAAGG - Intronic
929183182 2:39065627-39065649 GCACATATAATGGAAAAACATGG - Intronic
929326020 2:40611433-40611455 GCAGAGATTAAGCATAAAAATGG - Intergenic
930055290 2:47247277-47247299 GCAGATATTAGGTATACAAAGGG - Intergenic
930606017 2:53493776-53493798 GCATATAATAGGTAAAAACACGG + Intergenic
932882028 2:75511585-75511607 GCAGATATTAAGAAAATACAAGG - Intronic
933042419 2:77486465-77486487 ACACATATTAAGAAAACACACGG + Intronic
933532372 2:83526605-83526627 TCCCAAATTAAGTATCAACAGGG + Intergenic
933594611 2:84270458-84270480 GCACTTATTAAGAATAAATAAGG - Intergenic
933934429 2:87189970-87189992 GCAGCTTTTAAATATAAACATGG - Intergenic
934249971 2:90342833-90342855 GCACAAATTAAAAATAAATAGGG - Intergenic
934259601 2:91460608-91460630 GCACAAATTAAAAATAAATAGGG + Intergenic
936358713 2:111775925-111775947 GCAGCTTTTAAATATAAACATGG + Intronic
938735149 2:134179156-134179178 GCACAAAAAAAGGATAAACACGG - Intronic
939115970 2:138060940-138060962 GCACATTTTGTGTATAGACAAGG + Intergenic
939704545 2:145436213-145436235 GCACATATAATGCATCAACAGGG + Intergenic
939903988 2:147887624-147887646 GCATATATTTATTATCAACATGG + Intronic
941417248 2:165236134-165236156 ACAAATATTAGGTATAAACTAGG + Intergenic
942373081 2:175307223-175307245 GCCCATTTTAACTAGAAACAAGG - Intergenic
944570527 2:201040208-201040230 GAGCCTATTAAGTATAAACATGG + Intronic
945662459 2:212703044-212703066 GCACATAGAAAATATAAACTTGG + Intergenic
946218086 2:218201666-218201688 GCACAAATTAGTTATATACAGGG + Intergenic
947521514 2:230849642-230849664 GCAAATATTAACTAAAAAGATGG + Intergenic
1169314500 20:4577506-4577528 ACACATATTATTTAGAAACATGG + Intergenic
1171734389 20:28757054-28757076 TCACATAAAAAGTATAAAGAAGG - Intergenic
1171734397 20:28757226-28757248 TCACATAAAAACTATAAACAAGG - Intergenic
1171734438 20:28757958-28757980 TCACATAAAAAGTATAAACAAGG - Intergenic
1171742720 20:28920172-28920194 TCACATAAAAAGTATAAGCAAGG - Intergenic
1171762755 20:29223972-29223994 TCACATAAAAAGTATAAACAAGG + Intergenic
1171762812 20:29225003-29225025 TCACATAAAAAGTATAAAGAAGG + Intergenic
1171909631 20:30934823-30934845 TCACATAAAAAGTATAAACAAGG - Intergenic
1172943633 20:38671774-38671796 GCACATTTTAAGGATTGACACGG - Intergenic
1173954910 20:47023956-47023978 GGACATGTTAAGTAGAGACATGG - Intronic
1176324677 21:5381105-5381127 TCACATAAAAAGTATAAACAAGG + Intergenic
1176482230 21:7311521-7311543 TCACATAAAAAGTATAAACAAGG + Intergenic
1176761419 21:10797908-10797930 TCACATAAAAAGTATAAACAAGG + Intergenic
1176761475 21:10798934-10798956 TCACATAAAAAGTATAAAGAAGG + Intergenic
1177061252 21:16377004-16377026 GCACAAATTATGTCTAAATATGG - Intergenic
1177430102 21:20981693-20981715 GCACATTTTTAGTAGAGACAGGG + Intergenic
1178782078 21:35613267-35613289 GCAAATTAAAAGTATAAACAAGG - Intronic
1178796169 21:35746323-35746345 GCCCATATTTAGTATAAAAATGG - Intronic
1180112590 21:45669950-45669972 GCACAAATTAAGTAAAAGCAAGG - Intronic
1180401115 22:12426743-12426765 TCACATAAAAAGTATAAACAAGG + Intergenic
1182930222 22:34166601-34166623 GCAAATTTTAAGTATAAAATCGG + Intergenic
949526637 3:4911019-4911041 GCACATATACAGTGTAAACATGG + Intergenic
951354609 3:21649057-21649079 CCACATATTGAGTATCAAGATGG - Intronic
952023302 3:29048864-29048886 GCATCTATTTAGTAGAAACAGGG + Intergenic
952994304 3:38863096-38863118 GCAAATTTTAAGAATAAAGAAGG + Intronic
953763497 3:45713605-45713627 ACACATATGAGGTATAAACAGGG + Intronic
953967228 3:47318626-47318648 GCACATATTATTTAGAAAGATGG + Intronic
955659903 3:61287443-61287465 CCACATATTAAAGATAAATATGG - Intergenic
956496462 3:69831728-69831750 ATACTTATTAAGTATATACATGG + Intronic
957769159 3:84666414-84666436 GCAAATATTAAGGCTAAAAATGG + Intergenic
958510582 3:95041878-95041900 TCAAATATTAAGTATAAAACAGG - Intergenic
958894694 3:99816781-99816803 GAAGATATTATGTATAAATATGG - Intergenic
960445085 3:117738264-117738286 GAACATATTTAAAATAAACATGG + Intergenic
960461017 3:117936091-117936113 GCACATAGTATAAATAAACATGG + Intergenic
960595298 3:119402852-119402874 GCAAATATAAAGTAGAAATAAGG - Intronic
961243529 3:125432613-125432635 ACCCATATTTAGTATAAAAATGG + Intergenic
961728879 3:128952618-128952640 GGAGATATAAAGAATAAACAAGG + Intronic
961974939 3:131013824-131013846 GAACATGAGAAGTATAAACATGG + Intronic
962230454 3:133661509-133661531 ACAGATTTTAAATATAAACATGG + Intronic
963523445 3:146385595-146385617 GCAAATATAAAGTTTAAAAATGG - Intergenic
964589435 3:158343600-158343622 GAACATATTAAGTAGAGACATGG + Intronic
964778684 3:160310833-160310855 GAACATATTAATTGTAATCAAGG + Intronic
966642479 3:182206119-182206141 GGACATAATAAATAAAAACATGG + Intergenic
968197380 3:196718991-196719013 GCAAATATTAATAATAAATATGG - Intronic
971700821 4:29972724-29972746 GAAAATAATAGGTATAAACATGG + Intergenic
974291579 4:59938846-59938868 GCACATCTTGAGAATAAACAAGG - Intergenic
976911386 4:90311035-90311057 GCATATATTAATTATACAAAAGG - Intronic
977355503 4:95941268-95941290 GCACATATTAAGAGAAAACCAGG - Intergenic
979571427 4:122230773-122230795 GCACATATTAAATATACAATGGG - Intronic
979760844 4:124402343-124402365 GCAGATATTAGGTATAGATAGGG + Intergenic
980093991 4:128470987-128471009 GAACATATAAAGTATAGATACGG - Intergenic
980474200 4:133290281-133290303 ACACATATTATCTATATACAAGG - Intergenic
980568911 4:134584449-134584471 ACACATTTTAAGCAGAAACATGG - Intergenic
980858174 4:138465502-138465524 GCAGATGTTCAGTATAAACTTGG - Intergenic
981804284 4:148695287-148695309 GCCCATATTAAACATACACAAGG - Intergenic
984909044 4:184654865-184654887 CCACATATAAAGTATATACTAGG - Intronic
986026197 5:3853656-3853678 GCACATATTAATTTACAACAGGG + Intergenic
986943098 5:12980668-12980690 ACATATATTAAGTATATATAAGG - Intergenic
987521517 5:18991233-18991255 CCAAAAATTAAGAATAAACATGG + Intergenic
987732293 5:21790144-21790166 ACAAATATTAACTATAAACAAGG - Intronic
988793826 5:34633953-34633975 GCACATATTAAAAATAAACGGGG + Intergenic
989258940 5:39397510-39397532 GCAGATATTAAGTGTTAACTAGG - Intronic
990043713 5:51402678-51402700 ACACATATGAAGGAAAAACAAGG - Intergenic
991566026 5:68005260-68005282 GCAGATAGTAGGTATAAAGAAGG - Intergenic
992289029 5:75265726-75265748 GGAAATGTTAAGGATAAACATGG - Intergenic
993415253 5:87620718-87620740 GAACATATTAAGTATATATGAGG - Intergenic
995307226 5:110667071-110667093 GCACATAATTACAATAAACAAGG + Intronic
996934793 5:128936134-128936156 GAGCATGTTAAGTAAAAACATGG + Intronic
997306672 5:132842171-132842193 TCACAGAATAATTATAAACAAGG - Intergenic
999600583 5:153259170-153259192 GCACATTTTCAGTCTATACAGGG - Intergenic
1002796960 6:480011-480033 GCAAATAGTAAGCATAAAGAAGG - Intergenic
1005638864 6:27775914-27775936 GCCCATATTTAATATAAAAATGG + Intergenic
1008371008 6:50730559-50730581 GCACATTTTAAGTAAAAATGTGG + Intronic
1009955861 6:70452314-70452336 TTACATATCAAATATAAACATGG - Intronic
1010559358 6:77329817-77329839 GCACATACTATGTATATATAAGG + Intergenic
1011404570 6:87004802-87004824 GATCATATTATCTATAAACAAGG - Intronic
1011707575 6:90017676-90017698 GAACATCTTAAGTAGAGACATGG - Intronic
1012779624 6:103541116-103541138 ACACATATGGAGTATTAACATGG + Intergenic
1015649081 6:135434100-135434122 GAACATATTAATTTTAAATATGG + Intronic
1016635755 6:146288237-146288259 GCAGATAGTAGGTAGAAACAAGG + Intronic
1018321487 6:162614493-162614515 GCACACATTAAATATATTCAGGG - Intronic
1019850743 7:3554021-3554043 CCACATACTAAGCCTAAACAGGG + Intronic
1020751914 7:12151999-12152021 TCAAATATTAAGTAGCAACATGG - Intergenic
1020975521 7:15001371-15001393 ACATATATTAAGTATAAGCCTGG - Intergenic
1021057878 7:16073134-16073156 GCAAATATTAAGTATATATTAGG - Intergenic
1021193541 7:17649389-17649411 GCTCATATTAAGTTTCAACCAGG + Intergenic
1021570567 7:22060637-22060659 GATCATATAAAATATAAACAAGG + Intergenic
1022177276 7:27883828-27883850 GGACATATTAAGTAGAGAGAAGG - Intronic
1022928524 7:35083221-35083243 GCACATATTTAGTATCCACTTGG + Intergenic
1024458976 7:49640102-49640124 GCACATATTATGTCTACACTAGG - Intergenic
1028070540 7:86444595-86444617 GTATACCTTAAGTATAAACAAGG + Intergenic
1029824637 7:103176894-103176916 GCACATATTTAGTATCCACTTGG + Intergenic
1031470530 7:122163687-122163709 GATTATATTAAGCATAAACATGG + Intergenic
1032147011 7:129393108-129393130 AAACATATTAATTATAAACTGGG - Intronic
1036293504 8:7516897-7516919 GAACACATTAAATATAAAGATGG + Intergenic
1036329055 8:7804098-7804120 GAACACATTAAATATAAAGATGG - Intergenic
1036459352 8:8938264-8938286 CCACAAAGCAAGTATAAACATGG - Intergenic
1038390718 8:27198085-27198107 GAACATGTTAAGTAGAGACATGG - Intergenic
1040082349 8:43299882-43299904 GCAGTTATTAAGAATACACATGG + Intergenic
1040140769 8:43908922-43908944 TCACATATAAAGTATACAGAGGG + Intergenic
1042086485 8:65114945-65114967 CTACTTATTAAGTATATACATGG + Intergenic
1042117201 8:65445125-65445147 GTACATATTAAGTAAAATAAGGG - Intergenic
1043620638 8:82187892-82187914 GCACAAATTAAGAAGAAACAGGG - Intergenic
1044108273 8:88238719-88238741 ACACATATGCAGTATAAAAAAGG - Intronic
1044565961 8:93661519-93661541 GCAGATATCAAGAACAAACAAGG + Intergenic
1045609171 8:103814973-103814995 TCACATATTAAGTATAATGTTGG - Intronic
1046184336 8:110693265-110693287 GCACAACTTCAGTATACACATGG - Intergenic
1046279963 8:112014845-112014867 ACAAATATTAAGAATAAAAAAGG + Intergenic
1046903615 8:119548603-119548625 GAACATGTTAAGTAAAGACATGG + Intergenic
1049817530 8:144614109-144614131 GAACACATTAAGTAGAGACATGG - Intergenic
1049947951 9:616012-616034 TCTCATATTAAGGATCAACAGGG + Intronic
1051930136 9:22375183-22375205 ACACATATTAAGTGAAAAAAGGG - Intergenic
1052450487 9:28624102-28624124 GCTCATATTATCTACAAACAAGG + Intronic
1053240250 9:36488778-36488800 GCACCTATTAAGTGTCAGCATGG - Intergenic
1055173413 9:73288621-73288643 CCACACATTAGCTATAAACATGG - Intergenic
1055977944 9:81972718-81972740 GCATATTTTTAGTAGAAACAGGG + Intergenic
1056597542 9:88019999-88020021 TCACATATTAAGAATCAATAAGG - Intergenic
1058157054 9:101527738-101527760 TTACAAATTAAATATAAACAAGG + Intronic
1058428794 9:104899905-104899927 GCAGGTATTCAGTACAAACAGGG - Intronic
1059075573 9:111190052-111190074 GCACATAGTAGGTATATATATGG - Intergenic
1203382465 Un_KI270435v1:69404-69426 TCACATAAAAAGTATAAACAAGG + Intergenic
1203358261 Un_KI270442v1:184109-184131 TCACATAAAAAGTATAAACAAGG + Intergenic
1203402075 Un_KI270519v1:116842-116864 TCACATAAAAAGTATAAACAAGG + Intergenic
1189839562 X:45059871-45059893 GAAGACACTAAGTATAAACAGGG - Intronic
1193546882 X:82842412-82842434 TCACATAATAACTATAAATATGG - Intergenic
1193745283 X:85271190-85271212 ACTCACATTAAGTCTAAACATGG + Exonic
1193838968 X:86385228-86385250 TAACATATTAGGTATAAAGAAGG + Intronic
1194521181 X:94920280-94920302 GCACAAATGAAGTTTACACATGG + Intergenic
1194564172 X:95462414-95462436 GCCCATATTTAGTAGAAAAATGG + Intergenic
1195412135 X:104579028-104579050 GAACATATTGTTTATAAACATGG + Intronic
1195503146 X:105626547-105626569 GAAGATTTTAAATATAAACATGG + Intronic
1196135280 X:112202152-112202174 GCACATATTTGTTATAGACAGGG - Intergenic
1198045668 X:132899415-132899437 GGGCATGTTAAGTAGAAACATGG + Intronic
1200307557 X:155043267-155043289 GCACATAATAAGTAGAGGCAAGG - Intronic
1200388974 X:155923958-155923980 GCACATGTTAAGGAGACACATGG - Intronic
1200706190 Y:6444649-6444671 GAACATTTCAAGTATAAACTGGG - Intergenic
1201027921 Y:9720059-9720081 GAACATTTCAAGTATAAACTGGG + Intergenic