ID: 1081235058

View in Genome Browser
Species Human (GRCh38)
Location 11:40637028-40637050
Sequence TCTGGGCCCCCAGAGCAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 517
Summary {0: 1, 1: 1, 2: 2, 3: 45, 4: 468}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081235051_1081235058 5 Left 1081235051 11:40637000-40637022 CCCCTTAACCCTGCAACTGATTT 0: 1
1: 0
2: 1
3: 15
4: 147
Right 1081235058 11:40637028-40637050 TCTGGGCCCCCAGAGCAGCAAGG 0: 1
1: 1
2: 2
3: 45
4: 468
1081235055_1081235058 -4 Left 1081235055 11:40637009-40637031 CCTGCAACTGATTTTAGCATCTG 0: 1
1: 0
2: 1
3: 16
4: 152
Right 1081235058 11:40637028-40637050 TCTGGGCCCCCAGAGCAGCAAGG 0: 1
1: 1
2: 2
3: 45
4: 468
1081235054_1081235058 -3 Left 1081235054 11:40637008-40637030 CCCTGCAACTGATTTTAGCATCT 0: 1
1: 0
2: 1
3: 10
4: 187
Right 1081235058 11:40637028-40637050 TCTGGGCCCCCAGAGCAGCAAGG 0: 1
1: 1
2: 2
3: 45
4: 468
1081235050_1081235058 6 Left 1081235050 11:40636999-40637021 CCCCCTTAACCCTGCAACTGATT 0: 1
1: 0
2: 0
3: 10
4: 164
Right 1081235058 11:40637028-40637050 TCTGGGCCCCCAGAGCAGCAAGG 0: 1
1: 1
2: 2
3: 45
4: 468
1081235052_1081235058 4 Left 1081235052 11:40637001-40637023 CCCTTAACCCTGCAACTGATTTT 0: 1
1: 0
2: 1
3: 17
4: 193
Right 1081235058 11:40637028-40637050 TCTGGGCCCCCAGAGCAGCAAGG 0: 1
1: 1
2: 2
3: 45
4: 468
1081235049_1081235058 7 Left 1081235049 11:40636998-40637020 CCCCCCTTAACCCTGCAACTGAT 0: 1
1: 0
2: 1
3: 14
4: 147
Right 1081235058 11:40637028-40637050 TCTGGGCCCCCAGAGCAGCAAGG 0: 1
1: 1
2: 2
3: 45
4: 468
1081235053_1081235058 3 Left 1081235053 11:40637002-40637024 CCTTAACCCTGCAACTGATTTTA 0: 1
1: 0
2: 0
3: 12
4: 182
Right 1081235058 11:40637028-40637050 TCTGGGCCCCCAGAGCAGCAAGG 0: 1
1: 1
2: 2
3: 45
4: 468

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081235058 Original CRISPR TCTGGGCCCCCAGAGCAGCA AGG Intronic
900165982 1:1244547-1244569 GCTGGGACCCCAGGGCAGCGGGG + Intronic
900397766 1:2460228-2460250 CCTGGGACCCCGGGGCAGCATGG - Intronic
900408779 1:2503717-2503739 ACTGGGCCCCAGCAGCAGCAGGG + Intronic
900429449 1:2594929-2594951 GCCGGGCCCTCAGAGGAGCAAGG + Intronic
900498273 1:2986837-2986859 CCTGGGCCCCCAGAGCCTGATGG + Intergenic
900943203 1:5814450-5814472 TCCGGGCTCCCTGAGCAACACGG + Intergenic
900972902 1:6001250-6001272 TCAGGGCTCCAAGAGCACCAAGG - Intronic
901042839 1:6375820-6375842 TCTCGGCCTCCCGAGCAGCTGGG - Intronic
901069504 1:6510034-6510056 TCTGGACCCCCAGGGCAGCCGGG + Intronic
901324134 1:8356884-8356906 CCAGGGACCCCAGGGCAGCATGG - Intronic
901689854 1:10965607-10965629 CCTCGGCCCCCAGAGTAGCTGGG - Intronic
901879000 1:12182948-12182970 TCTGGGCCCCAAGAGAAGGGAGG + Intronic
902386467 1:16078707-16078729 TCTCAGCCCCCAGAGTAGCTGGG - Intergenic
903016353 1:20364673-20364695 GATGGGGCCCTAGAGCAGCAGGG + Intergenic
903375237 1:22861678-22861700 TCTGGGCCCCAAGAAAGGCAGGG + Intronic
903710423 1:25319491-25319513 TCTCAGCCTCCAGAGCAGCTGGG - Intronic
904336977 1:29804287-29804309 TCTGGGCCTCCAGAGAGGGAGGG - Intergenic
904438065 1:30512295-30512317 TCTGGGACCACAGAGCAGGATGG - Intergenic
904732513 1:32605587-32605609 TCTCAGCCCCCAGAGTAGCTGGG - Exonic
905518687 1:38580928-38580950 TCTGGGCCCCCAGAATTTCAAGG + Intergenic
906227390 1:44133075-44133097 TCTGAGCCCCCAGATCAAGACGG - Intronic
907276450 1:53319522-53319544 TCTATGCCCCCAAAGCAGCTAGG + Intronic
907965123 1:59321615-59321637 TCTGGTCCACCAGAGCTGCACGG - Exonic
908455892 1:64304652-64304674 CCTCGGCCTCCAGAGTAGCAGGG - Intergenic
910402613 1:86852512-86852534 TCTGAGCCTCCAGAGTAGCTGGG + Intergenic
912033148 1:105274797-105274819 ACTGTGCCCCCACAACAGCAAGG + Intergenic
912519070 1:110233109-110233131 TCTGGGCCCCGAGGGTCGCATGG - Exonic
912706446 1:111918575-111918597 TCTGTGCCCCCAAAGCACCATGG - Intronic
914351438 1:146843377-146843399 TGTGGTCCACCAGAGCAGCTAGG - Intergenic
914396674 1:147276209-147276231 TCTGGGCTCCCAGAGTAAAATGG - Exonic
915564403 1:156705734-156705756 TCTCGGTCCCCAGAGAAGCCTGG - Exonic
915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG + Exonic
916213626 1:162377925-162377947 TCTGGGACTCCAGAGAGGCAAGG + Intronic
916829986 1:168481140-168481162 TCTGGGACTCCACATCAGCAGGG + Intergenic
918081520 1:181211279-181211301 TCTGGACCCCCACAGCACCTTGG + Intergenic
920052366 1:203171754-203171776 GGTGGGCCCCCAGAGCGGGATGG - Intronic
920641274 1:207753553-207753575 CCTCGGCCCCCAGAGTAGCTGGG - Intronic
922040144 1:221888574-221888596 TCTGGGTCTCCAGAGCACCCTGG + Intergenic
922182640 1:223247324-223247346 TCTAGGCAGCCAGAGAAGCATGG - Intronic
922546158 1:226458577-226458599 TCTCAGCCTCCAGAGCAGCTGGG + Intergenic
923050301 1:230387000-230387022 TCCGGGCCCCTAAAGTAGCAGGG - Intronic
923469686 1:234279490-234279512 TCTGGGCCCTCAGACTAGCAGGG - Intronic
923522582 1:234747073-234747095 TCTGGGCCTCCAAGGCACCACGG - Intergenic
924691446 1:246355586-246355608 ACCGTGCCCCCACAGCAGCACGG - Intronic
924755285 1:246934977-246934999 TCTGTGCTCCCAGTGCAGCTGGG - Intergenic
1062773894 10:129192-129214 CCTGGGCCTCCCGAGCAGCTGGG - Intergenic
1062971699 10:1653650-1653672 TCTGTGCCTGCAGAGCCGCAGGG + Intronic
1062982588 10:1737460-1737482 TCTGGGCTCCCAGCGCAGGGAGG + Exonic
1063371055 10:5523440-5523462 TTGTGGACCCCAGAGCAGCAGGG - Intergenic
1064286691 10:13997736-13997758 TCTCAGCCCCCAGAGTAGCTGGG + Intronic
1064542445 10:16418666-16418688 TCTCAGCCTCCAGAGCAGCTGGG - Intergenic
1064806374 10:19138534-19138556 TCTCGGCCTCCAGAGTAGCTGGG + Intronic
1065051091 10:21792641-21792663 CCTGAGCCTCCAGAGCAGCAGGG - Intronic
1065575215 10:27111169-27111191 CCTTGGCCCCCAGAGTAGCTGGG + Exonic
1066056941 10:31690856-31690878 CCTTGGCCCCCTGAGCAGCTGGG - Intergenic
1066584985 10:36923044-36923066 TCTGGGCAGCCAGATCAGAAGGG - Intergenic
1067051870 10:43026263-43026285 CCTGGGCCCTCTGAGCAGAAGGG - Intergenic
1067899317 10:50222052-50222074 TCAGGGCGGCCAGAGCAGAATGG + Intronic
1067968478 10:50941801-50941823 TCTGCTCCCCCTGGGCAGCAGGG - Intergenic
1069775828 10:70926593-70926615 GCAGGGCCCCCAGAGCAGGCAGG - Intergenic
1069792763 10:71033799-71033821 CCTGAGCCTCCAGGGCAGCATGG + Intergenic
1069917657 10:71797326-71797348 TCCTGGCCCCCAGAGCAACTGGG - Intronic
1070173518 10:73950943-73950965 TCTGGGCTCCCATAGCATCCTGG + Intergenic
1070274036 10:74987315-74987337 TCTCGGCCTCCAGAGTAGCTGGG - Intronic
1070398256 10:76031640-76031662 GCTAGGCCCCCAGACCTGCAAGG - Intronic
1070592647 10:77811690-77811712 TGTGGTCCCCCTGACCAGCAGGG - Intronic
1070792717 10:79199084-79199106 TGTGAGCCCCCAGAGCAGAGGGG + Intronic
1070809931 10:79292657-79292679 TCTGGGCCCCCAACTCACCAAGG + Intronic
1071328191 10:84536985-84537007 TCTGACCCCAAAGAGCAGCAGGG + Intergenic
1072799156 10:98380800-98380822 CCTGTTTCCCCAGAGCAGCAGGG - Intergenic
1074103807 10:110374351-110374373 TCTGGGCTCCCAGAGCTGGCAGG + Intergenic
1074182893 10:111078797-111078819 TCTGGGCCCCGAGCGCAGCGCGG + Exonic
1075157771 10:119993291-119993313 TCTCAGCCTCCAGAGCAGCTGGG + Intergenic
1075358824 10:121810816-121810838 TCTCGGCCTCCTGAGCAGCTGGG + Intronic
1075392168 10:122100146-122100168 TCTCAGCCTCCCGAGCAGCAGGG - Intronic
1075878707 10:125830139-125830161 TGTGGGCCAGCAGAGAAGCAAGG + Intronic
1076265833 10:129109348-129109370 TCAGGGCTCCCAGAGAACCAGGG + Intergenic
1076350249 10:129810667-129810689 TCTGGGCCCACAGAGCAGCAGGG + Intergenic
1077018377 11:406849-406871 GCCGGGCCTCCAGAGCAGCAAGG + Exonic
1077122667 11:917510-917532 GCTGGGCCCACAGAGAAGCCTGG + Intergenic
1077162981 11:1122007-1122029 TGGGGGCTCCCAGGGCAGCAGGG - Intergenic
1077539156 11:3138566-3138588 CCTGGGCCCCCAGTGGAGCCTGG + Intronic
1078400038 11:11017929-11017951 TCTGGGGGCCCAGAGCAGGATGG + Intergenic
1079666468 11:23112679-23112701 TCTGTGTTCCCAGAGGAGCATGG + Intergenic
1079983998 11:27180742-27180764 TCTGGTCCCACAGAGCAGTGGGG - Intergenic
1081235058 11:40637028-40637050 TCTGGGCCCCCAGAGCAGCAAGG + Intronic
1082834109 11:57639531-57639553 CCCCTGCCCCCAGAGCAGCAGGG - Intergenic
1083611241 11:64005468-64005490 TGTGGGCCCCAAGAGCAGGGAGG + Intronic
1083796380 11:65019119-65019141 TCTGAGCCTCCAGAGTAGCTAGG - Intronic
1084459617 11:69289206-69289228 TCTCTGCCCCAGGAGCAGCAGGG + Intergenic
1084543212 11:69800169-69800191 TCCCGGACCCCACAGCAGCAGGG - Intergenic
1085130424 11:74033445-74033467 TCTAGCCTCCCAGAGCAGAAGGG - Exonic
1085741462 11:79081265-79081287 TCTGGGCCTAAAGAGCAGAAAGG - Intronic
1086597700 11:88593560-88593582 TCTCGGCCTCCAGAGTAGCTGGG - Intronic
1087047143 11:93851531-93851553 TCTGAGCCCCCAGAGCATGCTGG - Intergenic
1088342909 11:108789043-108789065 CCTGGGCTCACAGACCAGCAGGG - Intronic
1088704907 11:112453414-112453436 TCTCGGCCTCCAGAGTAGCTGGG + Intergenic
1088823319 11:113474762-113474784 GCGGGGCGCCCAGGGCAGCACGG - Intronic
1089557293 11:119321413-119321435 GCGGGGCCCGCAGAGCTGCAGGG - Intronic
1089591315 11:119542598-119542620 TCTCAGCCTCCAGAGCAGCTGGG - Intergenic
1089603870 11:119630469-119630491 GCTGGGCCGCCTGGGCAGCAGGG + Intronic
1090242987 11:125197123-125197145 TCTGTCCCCTCAGAGAAGCAGGG - Intronic
1092109688 12:5950342-5950364 TCTCGGTCCCCAGAGAGGCAGGG - Intronic
1092136312 12:6150081-6150103 TCTGGTCACCCAGTGCAGCAGGG - Intergenic
1092149895 12:6240705-6240727 CCTAGGGCCACAGAGCAGCAAGG - Intergenic
1092247705 12:6872772-6872794 GCTGGGCCCCCAGGTCAGGAGGG + Exonic
1092341672 12:7681801-7681823 CCTTGGCCCCCCAAGCAGCAAGG + Intergenic
1093954164 12:25197038-25197060 TCTCAGCCTCCAGAGCAGCTGGG - Intronic
1094006807 12:25762311-25762333 TTTCAGCCCCCTGAGCAGCAAGG - Intergenic
1094609142 12:31976565-31976587 TCTCAGCCTCCCGAGCAGCAGGG - Intronic
1095769412 12:45936255-45936277 TCTCGGCCTCCTGAGCAGCTGGG + Intronic
1095953671 12:47795041-47795063 TCTTGGGGCCCAGAGCTGCATGG - Intronic
1095984640 12:47991246-47991268 TCTGGCCTCTCAGAGCAGCATGG - Intronic
1096415427 12:51408343-51408365 TCTCGGCCTCCAGAGTAGCTAGG + Intronic
1096498984 12:52054233-52054255 ATTTGGGCCCCAGAGCAGCAAGG - Intronic
1096662952 12:53140332-53140354 TCTTAGCCCCCAGAGTAGCTGGG + Intergenic
1098159488 12:67635810-67635832 TCTTAGCCTCCAGAGTAGCAAGG - Intergenic
1100325339 12:93534964-93534986 TCTCAGCCTCCAGAGCAGCTGGG + Intergenic
1101098552 12:101368923-101368945 TCTCAGCAGCCAGAGCAGCACGG + Intronic
1101317584 12:103643528-103643550 TCTGGGCTCCCAGAGCACCCTGG + Intronic
1101803702 12:108045061-108045083 TCTGGTGCCCCAGATCAGCATGG - Intergenic
1101936970 12:109066134-109066156 TCTTGGCCTCCTGAGCAGCTGGG - Intronic
1102420492 12:112799536-112799558 TGTGTGCCACCAGAGCAGAAAGG - Intronic
1102686266 12:114727233-114727255 TCTCAGCCCCCCGAGCAGCTGGG + Intergenic
1103282474 12:119771466-119771488 TCTGGGCCCCAAGAGAAGCCTGG + Intronic
1103709284 12:122899304-122899326 TGTGAGTCCCCAGAGAAGCATGG - Intergenic
1103791016 12:123471184-123471206 TCTCGGCCTCCTGAGCAGCTGGG + Exonic
1104137628 12:125955593-125955615 TCTCAGCCCCCAGAGTCGCAGGG + Intergenic
1105022856 12:132828802-132828824 CCGGGGCTGCCAGAGCAGCAGGG - Intronic
1107008518 13:35643266-35643288 TCTGGGCTCCCAGGGCAGCCTGG + Intronic
1107940418 13:45377393-45377415 TCAGGGCCCCCAGCGCAGGAGGG - Intergenic
1108193118 13:47963527-47963549 TCTCGGCCCCCCGAGTAGCTGGG - Intronic
1108839261 13:54592742-54592764 TCTGGGCCCCCAGTGACTCATGG + Intergenic
1109919649 13:69039346-69039368 CCTCAGCCTCCAGAGCAGCAGGG - Intergenic
1110012676 13:70357426-70357448 CCTCAGCCCCCAAAGCAGCAGGG - Intergenic
1110537610 13:76669861-76669883 TCTCAGCCTCCAGAGTAGCAGGG + Intergenic
1111927261 13:94477209-94477231 TCTCAGCCCCCAGAGTAGCTGGG + Intronic
1112524872 13:100135274-100135296 TCTCAGCCTCCAGAGCAGCTAGG - Intronic
1112581720 13:100681955-100681977 TCTTGGCCTCCAGCGCTGCATGG - Intergenic
1113424696 13:110198475-110198497 CCTGGGCCCCCTGGGCAGCCTGG - Exonic
1113648010 13:112012485-112012507 TCTGAGCCCCCAGAGTGGCACGG - Intergenic
1114083285 14:19219641-19219663 TCAGGGCCCCCTGAGCTGCCCGG + Intergenic
1114808116 14:25861589-25861611 TCTGGGCTCCCAGACCTGGAAGG - Intergenic
1115256590 14:31409161-31409183 TCTCAGCCTCCAGAGCAGCTGGG + Intronic
1117708197 14:58495415-58495437 TCTCAGCCCCCAGAGTAGCTGGG + Intronic
1119058310 14:71447025-71447047 TCTCGGCCCCCTGAGTAGCTGGG + Intronic
1122138875 14:99650340-99650362 TCTGGGCCCCCAGAGCTTCGGGG - Intronic
1122431362 14:101649072-101649094 TCTCGGCCTCCAGAGTAGCTGGG + Intergenic
1122496089 14:102156614-102156636 TCTGGGAGGCCAGAGCAGAAGGG - Intronic
1122679411 14:103446404-103446426 TCTCAGCCTCCAGAGCAGCTAGG - Intronic
1122729186 14:103782918-103782940 TCTCGGCCCCCCGAGTAGCTGGG + Intronic
1122791854 14:104187390-104187412 TCTGGGCCCCGTGAGCAGACGGG + Intergenic
1122940997 14:104981349-104981371 TCTGGGGCCACAGGGGAGCATGG - Intergenic
1124802712 15:32849770-32849792 TCTCAGCCTCCAGAGCAGCTGGG + Intronic
1126774999 15:52092882-52092904 CCTCGGCCTCCAGAGCAGCTGGG - Intergenic
1128078193 15:64841464-64841486 TCTGGCCGCCCAGGGCAGCTCGG + Intergenic
1129332068 15:74832800-74832822 ACTGAGCCAGCAGAGCAGCAGGG - Intergenic
1129502385 15:76051677-76051699 CCTCGGCCTCCAGAGCAGCTGGG + Intronic
1129652480 15:77500942-77500964 TCTGGGCTTGCAGAGCAGGAAGG - Intergenic
1130014251 15:80174938-80174960 GCTGGGCCCCCATACCAGCCAGG - Intronic
1130937994 15:88486330-88486352 TCTTGGCCTCCTGAGCAGCTGGG - Intergenic
1132602220 16:778458-778480 TGTGGCCCCCTAGAGCAGGAGGG - Intronic
1132625088 16:887847-887869 TCTGGGCTCCCACACCTGCAGGG - Intronic
1132656989 16:1045552-1045574 CCTGGGCCCCCAGAGCAGGGTGG - Intergenic
1132668039 16:1090807-1090829 GCTGGGGCCCCACAGCAACAGGG + Intronic
1132924462 16:2421374-2421396 TCTCAGCCCCCTGAGTAGCAGGG - Intergenic
1133315370 16:4880309-4880331 TCTGCACCTCCTGAGCAGCAAGG - Exonic
1133793607 16:9028700-9028722 TCTCGGCCCCCTGAGGAGCTGGG + Intergenic
1134822401 16:17257289-17257311 TCTAGGCCCTGAGAGCAGAAAGG + Intronic
1135806026 16:25543433-25543455 TCTCGGCCTCCAGAGTAGCTGGG + Intergenic
1136271727 16:29152582-29152604 GCTGGGCCCACAGAGGGGCAGGG + Intergenic
1136990166 16:35147174-35147196 TCTGGGGCCCCAGGGGATCAGGG - Intergenic
1137835236 16:51585846-51585868 CCTTGGCCCCCAAAGTAGCAAGG + Intergenic
1137861597 16:51852017-51852039 TCTCGGCCCCCCGAGTAGCTGGG - Intergenic
1138391411 16:56672628-56672650 TCTCAGCCTCCAGAGCAGCTAGG - Intronic
1139491968 16:67291064-67291086 TCTGGGCCCACAGAGCCACAGGG + Intronic
1139574053 16:67830285-67830307 TCTGTGCCCCTAGAGCACCCTGG - Intronic
1139636701 16:68262427-68262449 TCTCGGCCTCCAGAGTAGCTAGG - Intergenic
1139710796 16:68774402-68774424 TCTTGGCCTCCTGAGCAGCTGGG - Intronic
1139982597 16:70872162-70872184 TGTGGTCCACCAGAGCAGCTAGG + Exonic
1141826051 16:86480946-86480968 TCTTGGCCACCAGAGGAGCAAGG + Intergenic
1142075394 16:88114742-88114764 GCTGGGCCCACAGAGGGGCAGGG + Intronic
1142162214 16:88563739-88563761 CCTCGGCCCTCAGAGCAGCTGGG - Intergenic
1143067783 17:4263635-4263657 GCGGGGCCCCGAGGGCAGCACGG - Exonic
1143084613 17:4406385-4406407 TCTCAGCCTCCAGAGCAGCTGGG + Intergenic
1143343500 17:6232480-6232502 TCAGAGCCACCAGAACAGCAAGG - Intergenic
1143751878 17:9034149-9034171 GCTGGGCCCCCAGGACACCAAGG - Intronic
1144684862 17:17219340-17219362 CCAGGGCTCCCAGAGCAACAGGG - Intronic
1144889385 17:18485297-18485319 TCTCATCCCCCAGAGCAGCTGGG + Intronic
1145142825 17:20458999-20459021 TCTCATCCCCCAGAGCAGCTGGG - Intronic
1145934968 17:28709879-28709901 CCTTGGCCTCCAGAGCAGCTGGG - Intronic
1145984384 17:29035362-29035384 TCTCGGCCTCCAGAGTAGCTGGG + Intronic
1146694181 17:34896423-34896445 TCAGGGCTTCCAGAGCAGCATGG - Intergenic
1146945212 17:36869078-36869100 TCTGGGCCCCCTGGGCCTCATGG + Intergenic
1146968610 17:37054213-37054235 CCTGGGGCCCAGGAGCAGCATGG - Intronic
1149334898 17:55625676-55625698 TGTGGGGCCCCACAGCAGCCAGG - Intergenic
1149359873 17:55883823-55883845 TCTCGGCCTCCAGAGTAGCTGGG + Intergenic
1150230159 17:63545360-63545382 TCTGTGGCCCCAGAGCAGCCAGG + Intronic
1150918997 17:69463901-69463923 TCTCAGCCCCCAGAGTAGCTGGG - Intronic
1151473516 17:74332359-74332381 TCTGGGGCCCCAGAGGAGCCAGG + Intronic
1151493606 17:74446689-74446711 GCTGGGCCCCAGGAGCAGCCTGG - Intronic
1151567765 17:74909205-74909227 GTTGGGACCCCAGAGCTGCATGG - Intergenic
1151704080 17:75757635-75757657 GCTGGGCCCCCAGGGGTGCAAGG - Exonic
1151726426 17:75887529-75887551 TCTCAGCCCCCAGAGTAGCTAGG - Intronic
1152184182 17:78843888-78843910 TCTCGGCCTCCAGAGTAGCTGGG + Intergenic
1152359790 17:79826552-79826574 TCTGAGCCTCCAGAGGAGCTGGG - Intergenic
1152376109 17:79919828-79919850 CCTGGGCCCCTAGAGTAGAAAGG + Intergenic
1152655535 17:81517678-81517700 TGTGGCCTCCCAGAGCCGCACGG + Intronic
1152748665 17:82052534-82052556 CCTCGGCCAGCAGAGCAGCAGGG - Intronic
1152862276 17:82703301-82703323 CCTGGGCCCCCAGTGCTGAATGG - Intergenic
1153503237 18:5769810-5769832 TCTGGGCCCCTTCAGCAGCAGGG + Intergenic
1153649719 18:7229340-7229362 TCAGGGTCCCAGGAGCAGCAGGG + Intergenic
1155128427 18:22903824-22903846 TCTTGGCCTCCTGAGCAGCTGGG - Intronic
1155158646 18:23178278-23178300 TGTGTGCCCCTACAGCAGCAGGG + Intronic
1155917850 18:31573505-31573527 TCTGGGCCTCCAGAGTATGAGGG + Intergenic
1156012363 18:32510021-32510043 TCTGGGGCCACAGAGCAGCATGG - Intergenic
1157472983 18:48003920-48003942 GCTGGGCCCTCAGAGCTGCAGGG - Intergenic
1158585246 18:58727417-58727439 CCTGAGCCCCCAGAGTAGCTGGG + Intronic
1158905893 18:62011383-62011405 TGTGGGCCCTGAGAGCTGCATGG - Intergenic
1159252483 18:65897474-65897496 TCTTAGCCCCCTGAGCAGCTGGG - Intergenic
1160906532 19:1454041-1454063 TCTGGGCACCCTGTGCAGCTGGG + Intronic
1160917746 19:1505635-1505657 TCTGGGTACCCAGGGCAGCAGGG + Exonic
1160942075 19:1625095-1625117 TCTCGGCCTCCAGAGAAGCTGGG + Intronic
1161085380 19:2332758-2332780 TGTGGGCCCCCAGGGGAGCCCGG - Intronic
1161166151 19:2788874-2788896 TCTCGGCCTCCAGAGTAGCTAGG + Intronic
1161284991 19:3464213-3464235 GCTGGGCCCCCAGAGGAGAGAGG + Intronic
1161592880 19:5136659-5136681 TCACTGCCTCCAGAGCAGCAGGG - Intronic
1161785963 19:6325742-6325764 TCTCAGCCCCCAGAGTAGCTGGG - Intronic
1162136027 19:8555787-8555809 TCTCACCCCCCAGGGCAGCAAGG - Exonic
1162861724 19:13510701-13510723 TCTTGGCCTCCAGAGTAGCTGGG - Intronic
1162916974 19:13879908-13879930 TCTCAGCCCCCCGAGTAGCAGGG - Intronic
1163190977 19:15676246-15676268 TCTGGGAACCCAGAGAACCAAGG + Intronic
1163479100 19:17544176-17544198 TCTTGGCCTCCAGAGTAGCTGGG - Intronic
1163759870 19:19130374-19130396 TCTGGGACCCCAGAACTCCAGGG + Intronic
1164536498 19:29089778-29089800 GCCGGGCCCCCAGTGCAGCGTGG + Intergenic
1164752590 19:30667696-30667718 TCTGGGCTTCCAGAGCAGGTAGG - Intronic
1165293410 19:34906800-34906822 CCTCGGCCTCCAGAGCAGCTAGG + Intergenic
1165424563 19:35738743-35738765 CCTGGGCCCCCAGGGCAGAAAGG - Exonic
1166291519 19:41866612-41866634 TCTTGGCCCCCAGCAGAGCATGG + Intronic
1166624403 19:44336991-44337013 CCTGGGCCTCCAGAGTAGCCGGG + Intronic
1167298178 19:48663994-48664016 TCTGGGCCCTCGGATAAGCAGGG - Intronic
1167603681 19:50468717-50468739 CCTCGGCCTCCAGAGCAGCTGGG + Intronic
1167884226 19:52487211-52487233 GCTTGGCCACCAGAGCAGCTGGG - Intronic
1167914953 19:52733414-52733436 GCTTGGCCACCAGAGCAGCTGGG + Intronic
1167962649 19:53119327-53119349 TCTCGGCCTCCAGAGTAGCTGGG - Intronic
1167973208 19:53202033-53202055 CCTGGGCCCCCTGAGTAGCTGGG + Intergenic
1167977277 19:53239930-53239952 ACTGGCCACCCAGGGCAGCACGG + Intronic
1168168261 19:54569910-54569932 TCTTGGCCCCCAGAGAGACAGGG + Intergenic
1168270888 19:55249162-55249184 GCAGGCCCCCCAGAGGAGCAGGG - Intronic
1168326191 19:55539654-55539676 TCTGCTCCCACAGAGCACCACGG - Intergenic
1168466587 19:56607088-56607110 TCTGGGCTACCAGAAAAGCATGG + Intronic
1168606958 19:57767802-57767824 TCTCAGCCCCCCGAGCAGCTGGG - Intergenic
925618996 2:5772130-5772152 TCCAGGGCCCCTGAGCAGCATGG + Intergenic
926272596 2:11377907-11377929 TCTTGGCCCCCCGAGTAGCTGGG - Intergenic
927504500 2:23604217-23604239 TCTGGGCCTCCCGAGTAGCTGGG + Intronic
927688121 2:25187069-25187091 TCTCAGCCTCCTGAGCAGCAGGG + Intergenic
927786755 2:25980216-25980238 AATGTGCCCCCAGAGCAGCCAGG - Intronic
927943257 2:27118857-27118879 GCTGGACCCCCAGAGCCGCGCGG - Exonic
928100639 2:28435588-28435610 TGTGGGCCCACAGAGAAGGATGG - Intergenic
928126735 2:28621489-28621511 TCAGGGCCCCCAAAACAGCATGG + Intronic
928294445 2:30070612-30070634 CCTCGGCCCCCTGAGCAGCTGGG - Intergenic
928728350 2:34202156-34202178 TCTGGGCCACCACAGAAGGAAGG - Intergenic
929001258 2:37349189-37349211 TCTTTGCCCCCAGAGGGGCAAGG + Intronic
929591300 2:43148918-43148940 TCTCAGCCTCCAGAGCAGCTGGG + Intergenic
929611397 2:43273461-43273483 TCTGGCACCACAGAGCAGAAAGG + Intronic
930024358 2:47021255-47021277 TCTGGGCCCCCATAGGAGTCAGG - Intronic
931646260 2:64424669-64424691 CCTTGGCCCCCAGAGGGGCAGGG - Intergenic
932212628 2:69945124-69945146 TCTCAGCCTCCAGAGCAGCTGGG - Intergenic
932581549 2:72995520-72995542 TCAGGGCCCCCAGAGGAGGCTGG + Intronic
932661968 2:73662926-73662948 CCTTGGACCCCAGAGCAGCCTGG - Intergenic
932698092 2:73973802-73973824 TCTCAGCCTCCAGAGCAGCTGGG + Intergenic
933959831 2:87400925-87400947 CCTGGGCCTCCCGAGCAGCTGGG - Intergenic
934181420 2:89625360-89625382 CCTCGGCCTCCAGAGTAGCAGGG - Intergenic
934683440 2:96303158-96303180 CCTGGTCCCCAAGAGCAGCCTGG + Exonic
935686560 2:105688988-105689010 GCTGTGCCCCCAGCTCAGCAGGG + Intergenic
936903062 2:117505868-117505890 TCTCAGCCCCCAGAGTAGCTGGG - Intergenic
937268073 2:120629789-120629811 TCTGGGCCCCGAGAGCAGACTGG - Intergenic
937630834 2:124099309-124099331 TCTGGGTCTCTAGAGCAGGAAGG + Intronic
938040069 2:128068495-128068517 CCTCGGCCTCCAGAGCAGCTGGG + Intergenic
938103602 2:128514582-128514604 GCTGGGCCCTCAGACCAGCTAGG + Intergenic
938297152 2:130185530-130185552 TCAGAGCCCAGAGAGCAGCAAGG + Intronic
938368860 2:130756356-130756378 TGGGGGCCCGCAGTGCAGCAGGG - Exonic
938459618 2:131489130-131489152 TCAGAGCCCAGAGAGCAGCAAGG - Intronic
938694672 2:133824490-133824512 CCTGGACCCCGAGAACAGCACGG + Intergenic
941279694 2:163534682-163534704 TCTCAGCCTCCAGAGCAGCTGGG + Intergenic
941828120 2:169922168-169922190 CCTCGGCCCCCTGAGCAGCTGGG - Intronic
944545946 2:200799103-200799125 TCTTGGCCTCCAGAGTAGCTAGG + Intergenic
944687515 2:202130799-202130821 CCTGAGCCCCCAGAGTAGCTGGG - Intronic
945096310 2:206222857-206222879 TCTCGGCCTCCTGAGCAGCTAGG + Intergenic
946397733 2:219451700-219451722 CCTGGCCTCCCTGAGCAGCAGGG - Exonic
946435922 2:219653605-219653627 TCTCAGCCTCCTGAGCAGCAGGG - Intergenic
946491359 2:220152164-220152186 GCTGGGCCCCAGGATCAGCATGG - Intergenic
946825579 2:223674217-223674239 TCTTGGCCCCCAGAGTAGCTGGG + Intergenic
947080139 2:226386988-226387010 TCTCAGCCTCCAGAGCAGCTGGG + Intergenic
947495735 2:230635151-230635173 TCTCAGCCCTCAGAGCAGCTGGG - Intergenic
948042005 2:234909599-234909621 AATGGGCCCACAGAGCAACAGGG - Intergenic
948352270 2:237350795-237350817 TCTGAGCCATCAGAGCAGCCGGG - Intronic
948618255 2:239215382-239215404 GCTGGGAGCCCAGAGAAGCAGGG + Intronic
949062134 2:241967368-241967390 TCAGGGCCAACAGAGCAACAAGG + Intergenic
1169881532 20:10352069-10352091 TCTTAGCCCCCAAAGTAGCAGGG - Intergenic
1171346142 20:24468334-24468356 TTTAGGTCCCCAGAGCTGCAAGG - Intergenic
1171947690 20:31392924-31392946 TCTTGGCCCCCTGAGTAGCAGGG - Intergenic
1171972429 20:31572819-31572841 TCTGGGGTCCCTGAGGAGCAAGG + Intronic
1172160997 20:32867950-32867972 TCTCAGCCCCCAGAGTAGCTGGG + Intronic
1172409032 20:34709047-34709069 TCAGGTCCCCTAGGGCAGCAGGG + Intronic
1172769756 20:37374688-37374710 TCTCAGCCTCCAGAGCAGCTTGG + Intronic
1172874783 20:38157384-38157406 TCTGGGACCCCAGGCCTGCATGG - Intronic
1173799973 20:45888983-45889005 GCTGGGCCCAGAGAGCAGTAAGG - Intronic
1174539537 20:51278073-51278095 TCTGGGCTCCTAGAGCTGCTTGG - Intergenic
1174821976 20:53734207-53734229 TCTTTGTCCCAAGAGCAGCAAGG + Intergenic
1174852769 20:54011752-54011774 TCTCAGCCCCCAGAGTAGCTGGG - Intronic
1175403436 20:58713188-58713210 TCTGGCTCTCCAGAGCAGCGGGG + Intronic
1175537002 20:59721806-59721828 TGTATGCCCACAGAGCAGCAGGG - Intronic
1175608410 20:60330210-60330232 TCCTGGCCCCCAGAACTGCAAGG + Intergenic
1175922064 20:62454813-62454835 TCTGGGCCCCCACAAGAGCTGGG + Intergenic
1178095675 21:29212500-29212522 TCTGGGCCCCAGCAACAGCACGG - Intronic
1178589349 21:33896235-33896257 TCTGGGCTCCCAGTTCAGGATGG + Exonic
1180294689 22:10873626-10873648 TCAGGGCCCCCTGAGCTGCCCGG - Intergenic
1180497495 22:15903040-15903062 TCAGGGCCCCCTGAGCTGCCCGG - Intergenic
1180595980 22:16973689-16973711 TCTGTGCCCCCATAGCACCTGGG + Intronic
1180600740 22:17013448-17013470 TCTAGGCTCCAAGAACAGCAGGG + Intergenic
1181081449 22:20418421-20418443 CCTGGGCCTCCCGAGCAGCTGGG - Intergenic
1181790611 22:25262890-25262912 TCTGGGGCCCCAGAGGAGTGAGG + Intergenic
1182348514 22:29684332-29684354 TCATGGCACCCAGAGCAGCCAGG + Intronic
1182536685 22:31009003-31009025 TCTCGGCCCCCCGAGTAGCTGGG + Intergenic
1182702536 22:32252112-32252134 CCTCAGCCTCCAGAGCAGCAGGG - Intronic
1182782839 22:32881563-32881585 TCTCCGCCCCCAGAGCACCCAGG + Intronic
1183741085 22:39669027-39669049 TCTGAGACCCCTGAGTAGCAGGG + Intronic
1184105769 22:42366798-42366820 ACAGGGCCCCCAGAGTAGCTGGG - Intergenic
1184281455 22:43439936-43439958 TCTGGGCGTACAGAGGAGCAGGG - Intronic
1184616908 22:45644649-45644671 TCTCGGCCTCCCGAGCAGCTGGG - Intergenic
1184704515 22:46201463-46201485 TCATGGCCCCCAGAGCAGTGGGG + Intronic
1184749032 22:46473595-46473617 TCTGGACCCCGAGGGCATCATGG - Intronic
1184987445 22:48145372-48145394 ACTTGGCCCCAGGAGCAGCAGGG - Intergenic
1185288990 22:50014710-50014732 TCTGGGTCTCCAGGGCAGCACGG + Intergenic
1185378454 22:50494371-50494393 TCTTGGCCTCCAGAGTAGTAGGG + Intergenic
949321136 3:2811780-2811802 TCTCAGCCTCCAGAGCAGCTGGG + Intronic
950466728 3:13160175-13160197 TCTTAGCCTCCGGAGCAGCAGGG - Intergenic
950631470 3:14284858-14284880 CCAGTGCCTCCAGAGCAGCAGGG - Intergenic
952205058 3:31172931-31172953 TTTCGGCCCAGAGAGCAGCAAGG - Intergenic
952316787 3:32238737-32238759 TCTAGGGCCCCAGCGCAGCTCGG + Exonic
953353084 3:42230489-42230511 TCTGGATTCCCAGAGCAGCATGG - Intergenic
953734401 3:45479403-45479425 GCGAGGCCCCCAGAACAGCAGGG + Intronic
954085433 3:48240443-48240465 CCTGGGCTCCTAGAGCAGGATGG - Intergenic
954627922 3:52032852-52032874 TCTGAGCCCACAGAACACCAGGG + Intergenic
955741082 3:62092322-62092344 CCTCGGCCTCCCGAGCAGCAGGG - Intronic
956937916 3:74124852-74124874 TCTAGGCCGACAGAACAGCAGGG + Intergenic
956944183 3:74200034-74200056 TCTCAGCCCCCAGAGTAGCTGGG + Intergenic
961308219 3:125974597-125974619 TGTGGGTCACCAAAGCAGCATGG - Intronic
963294688 3:143533022-143533044 TGTGGGCCCCAAGGGGAGCAGGG + Intronic
964617428 3:158682917-158682939 TCTCAGCCTCCAGAGCAGCTGGG - Intronic
964744320 3:159998020-159998042 TCTGGGCCCAGAGATCAGGAGGG + Intergenic
967922796 3:194625274-194625296 TCCAGGCACACAGAGCAGCATGG - Intronic
969037766 4:4269156-4269178 TCGGGGCCTGCAGAGCAACACGG + Intronic
969288345 4:6222240-6222262 TCTGGGCGCCCGGCGCAGCGCGG + Intergenic
969382175 4:6809422-6809444 TCTGGCCCCCTAGACTAGCAGGG + Intronic
969595724 4:8148363-8148385 TCTGGGCCTACAGTGAAGCAGGG + Intronic
969613515 4:8239810-8239832 CCAGGTCCCCCAGAGGAGCAGGG + Intronic
969646502 4:8432698-8432720 TCAGGGCGCTCAGAGCAGCCAGG + Intronic
969867767 4:10086658-10086680 GCTGGTCCCCCAGAGCTCCACGG + Intronic
971014271 4:22471106-22471128 TCTGCTCCTCCAGAGGAGCAGGG + Intronic
972037973 4:34550973-34550995 CCTCGGCCTCCAGAGCAGCTGGG + Intergenic
972328739 4:38043465-38043487 CCTCGGCCCCCAGAGTAGCTGGG - Intronic
972424036 4:38915950-38915972 TCTGGGCCTCCAGAGAGGGAGGG + Intronic
972695348 4:41439786-41439808 CCTCAGCCTCCAGAGCAGCAGGG - Intronic
974224338 4:59019042-59019064 TTTAGGCCCCCAGAGCAGTTTGG + Intergenic
974377115 4:61093110-61093132 TCTGGGCCCTCACAGCAGTGTGG - Intergenic
975406225 4:73993685-73993707 CCTCGGCCTCCAGAGTAGCAGGG - Intergenic
976211653 4:82677344-82677366 TCTGGGCCCCAAATGCAGCTGGG + Intronic
978127580 4:105152710-105152732 TCTCAGCCCCCAGAGTAGCTGGG + Intronic
980565253 4:134531280-134531302 TCTGGGCTCCAAGAATAGCAAGG - Intergenic
980896844 4:138868490-138868512 TGTGGTCCCCCAGACCAGTAAGG + Intergenic
980940686 4:139271408-139271430 CCTCGGCCCCCTGAGCAGCTGGG - Intronic
981416508 4:144500085-144500107 TCTGGGCCACCAAAGCAACAAGG - Intergenic
982703825 4:158686224-158686246 TCTGAGCCCCAATAGCAGAAAGG + Intronic
983800496 4:171923511-171923533 TCTCAGCCTCCAGAGTAGCAGGG + Intronic
985131247 4:186740676-186740698 TCTGGGCTCCCACTGAAGCAAGG + Intergenic
985509901 5:307542-307564 TCTCAGCCCTGAGAGCAGCACGG - Intronic
985668674 5:1195308-1195330 TCTGGGGCCCCAAGGCTGCAGGG + Intergenic
987784716 5:22485295-22485317 TCTCAGCCTCCAGAGCAGTAGGG + Intronic
988521946 5:31953998-31954020 TCTCCGCCTCCAGAGCAGCTAGG - Intronic
988563295 5:32299995-32300017 TCTGTGCCCCCAGAGCACTTGGG + Intronic
989426742 5:41304372-41304394 TCTGGGCACTCAGAAAAGCATGG + Intergenic
995466586 5:112456061-112456083 CCTCAGCCCCCGGAGCAGCAGGG - Intergenic
995497185 5:112758717-112758739 CCTGGGCTCCCAGAGTAGCTGGG + Intronic
996173914 5:120331541-120331563 TCTCGGCCTCCCGAGCAGCTGGG + Intergenic
997958143 5:138296719-138296741 CCTCGGCCCCCAGAGTAGCTGGG + Intronic
998270346 5:140700759-140700781 TCTGGGCCCCTAGAGAAGCAGGG - Intronic
999780835 5:154848849-154848871 TCTCAGCCTCCAGAGCAGCTGGG - Intronic
1000244376 5:159437088-159437110 TCTGGGGTCCCTGAGGAGCAGGG + Intergenic
1001523003 5:172408382-172408404 TCTCAGCCTCCAGAGCAGCTGGG + Intronic
1001550325 5:172598079-172598101 TCTGGGCCCCCAGGAGAGGAAGG + Intergenic
1002191429 5:177479846-177479868 TCTGGGAACGCCGAGCAGCACGG - Intergenic
1002596583 5:180327737-180327759 GGTGGGCCCCCAGTGCTGCATGG - Intronic
1002941063 6:1716644-1716666 TCTGGGAACCCTGAGAAGCAAGG - Intronic
1003667863 6:8128358-8128380 GCTGGGACCCAAGAGCAGCATGG + Intergenic
1004178634 6:13362344-13362366 TCTCAGCCTCCCGAGCAGCAGGG - Exonic
1004316370 6:14591636-14591658 TCTCAGCCTCCAGAGCAGCTGGG - Intergenic
1005078906 6:21936964-21936986 TCTTGGCCTCCAGAGTAGCTGGG - Intergenic
1007645495 6:43377248-43377270 TCTGGTCCCCCAGATCACCATGG + Intergenic
1008036956 6:46755326-46755348 TCTGAGCCCTCAGAGCAGCTTGG + Intronic
1008387233 6:50905777-50905799 TCTCGGCCTCCAGAGTAGCAGGG + Intergenic
1008651713 6:53570526-53570548 CCTGGGCCTCCAGAGTAGCTGGG + Intronic
1009407989 6:63332460-63332482 GTTGGGACCCCAGAGCTGCATGG + Intergenic
1010830935 6:80528158-80528180 TCTTGGCCCCTGGAGCACCATGG - Intergenic
1011079456 6:83473463-83473485 TCTCGGCCCCCTGAGTAGCTAGG - Intergenic
1011769599 6:90661035-90661057 TCTGGGCCCCCAGAACAAAGAGG + Intergenic
1011911906 6:92450499-92450521 TCTGGGCAGCCAGGGTAGCAGGG - Intergenic
1013207596 6:107958491-107958513 TCTGGGACCCCTGCGCAGCCAGG - Intergenic
1013315276 6:108936370-108936392 CCTGGGCCTCCAGAGTAGCTGGG + Intronic
1013818617 6:114129369-114129391 CCTGGGCCTCCAGAGTAGCTGGG + Intronic
1015250166 6:131119009-131119031 TCTCGGCCTCCAGAGTAGCTGGG - Intergenic
1015318407 6:131843747-131843769 GCTGGGCTCCCAGAGCTGGAGGG + Intronic
1016282863 6:142439033-142439055 TCTCAGCCTCCAGAGCAGCTGGG - Intronic
1016715744 6:147226185-147226207 TCTCAGCCTCCAGAGCAGCTGGG - Intronic
1016902655 6:149117552-149117574 TCTGTGCCCTCAGAAGAGCATGG - Intergenic
1017906884 6:158762799-158762821 TCTCAGCCTCCAGAGCAGCTAGG - Intronic
1018372339 6:163179588-163179610 TCTCGGCCTCCCGAGTAGCAGGG - Intronic
1018979032 6:168588237-168588259 TCTCGGCCCCCTGAGTAGCTGGG + Intronic
1019020887 6:168916744-168916766 TGTGGGGCCCCAGGGCAGCTTGG - Intergenic
1019323460 7:426030-426052 GCTGGGCCCCCAGACCAGGTGGG + Intergenic
1019337583 7:492616-492638 TCTAAGCCTACAGAGCAGCAGGG + Intergenic
1019487576 7:1296393-1296415 TCCGGGCCCCCTGCGCTGCAAGG + Intergenic
1019495154 7:1334741-1334763 TCTCCGCCTCCAGAGCAGCTGGG + Intergenic
1019552071 7:1608187-1608209 TCTGCACCCCCAGAGCCACACGG - Intergenic
1019661169 7:2224810-2224832 CCTGGCTCCCCAGGGCAGCAGGG - Intronic
1020033413 7:4948925-4948947 CCTTGGCCTCCAGAGCAGCTGGG + Intronic
1020961969 7:14816216-14816238 TCTCGGCCTCCAGAGTAGCTGGG - Intronic
1021127027 7:16862953-16862975 TCTCAGCCTCCAGAGCAGCTGGG - Intronic
1021599784 7:22354186-22354208 TGTGGGAGCCCAGGGCAGCATGG + Intronic
1022086931 7:27077623-27077645 CCTCGGCCCCCCGAGTAGCAGGG - Intergenic
1023875385 7:44283772-44283794 TCTCTGCCCCCAGAGCTGGAGGG - Intronic
1026111593 7:67462844-67462866 GATGGGCCTCCAGGGCAGCAGGG + Intergenic
1026536598 7:71243653-71243675 TCTTGGCCTCCAGAGTAGCTGGG + Intronic
1026741872 7:72983962-72983984 CATGGGTCCCCAGGGCAGCAGGG - Intergenic
1026801716 7:73404387-73404409 CATGGGTCCCCAGGGCAGCAGGG - Intergenic
1027101863 7:75381115-75381137 CATGGGTCCCCAGGGCAGCAGGG + Intergenic
1027850414 7:83444784-83444806 CCTCAGCCCCCAGAGCAGCCGGG + Intronic
1028172071 7:87610351-87610373 TCTTGGCCTCCAGAGTAGCTGGG + Intronic
1028773583 7:94655733-94655755 TCTGCGCCCGCAGAGCAGGGAGG + Intronic
1029206833 7:98874430-98874452 CCTCGGCCTCCAGAGTAGCAAGG + Intergenic
1029284928 7:99458785-99458807 TCTGGTACCCCAGAAAAGCATGG - Intronic
1029308566 7:99640272-99640294 TCTCAGCCCCCAGAGTAGCTGGG + Intergenic
1029436797 7:100568250-100568272 CCTGGGCCCGGAGTGCAGCAGGG + Intergenic
1030787974 7:113685490-113685512 TCTCAGCTCCCAGAGCAGCTGGG + Intergenic
1031365857 7:120900308-120900330 TTTTGGCCCCCAAAGCTGCAAGG + Intergenic
1032514317 7:132495510-132495532 GCTGCTGCCCCAGAGCAGCAGGG - Intronic
1032596685 7:133248003-133248025 CCTCAGCCCCCAGAGCAGCTGGG + Intergenic
1032844011 7:135737224-135737246 TCTGGGCGCACACAGCAGCCAGG - Intronic
1034070879 7:148183595-148183617 CCTTGGCCCCCAGAGTAGCTGGG + Intronic
1034142890 7:148838934-148838956 CCTTGGCCTCCAGAGCAGCTGGG - Intronic
1035830940 8:2693786-2693808 TCTCAGCCTCCAGAGCAGCTGGG + Intergenic
1036594576 8:10200437-10200459 TCTGGGTACCCACAGCAGCTGGG + Intronic
1037779938 8:21861017-21861039 TCTGAGCCTCCAAAGCTGCAAGG - Intergenic
1038024211 8:23574485-23574507 TCAGGGCCCACAGAGCTCCAGGG - Exonic
1038788933 8:30649727-30649749 TCAGGCCCCCCAGAGTAGCCGGG - Intronic
1038840526 8:31180668-31180690 TCTTGGCCCCCAAAGAATCAAGG + Intergenic
1038900297 8:31834593-31834615 CCTCAGCCTCCAGAGCAGCAGGG - Intronic
1042545293 8:69945952-69945974 TCTCAGCCTCCAGAGCAGCTGGG - Intergenic
1043388726 8:79770738-79770760 CCTCGGCCCCCAGAGTAGCTAGG - Intergenic
1043810494 8:84733031-84733053 TCTGGGCCACAAGAGGACCAAGG - Intronic
1044875096 8:96657372-96657394 CCTGCTCCCCCAGATCAGCATGG - Intronic
1045612632 8:103864022-103864044 CCTCAGCCCCCAGAGCAGCTGGG + Intronic
1046536874 8:115526097-115526119 TCTGGGTCTCGAGAGCAGCCTGG + Intronic
1046593204 8:116230034-116230056 TCTGAGGCCTCAGAGCAGAAAGG - Intergenic
1047400451 8:124542029-124542051 CCTTGGCCCCCAGAGTAGCTGGG + Intronic
1047448061 8:124937574-124937596 TGTGGGCCCACAGAGCAACTAGG - Intergenic
1048267208 8:132998241-132998263 TCTGGCCTCCCAGAGCAAAAAGG - Intronic
1048853717 8:138669007-138669029 TCTGTGCTCAGAGAGCAGCAGGG + Intronic
1048982532 8:139710522-139710544 GCTGGGCCTCTAGGGCAGCAGGG + Intergenic
1049196965 8:141320989-141321011 TCTGAGGCCCCAAAGCAGGAAGG + Intergenic
1049565890 8:143338809-143338831 TCTGGGCCTGCAGACCAGAAGGG + Intronic
1049649719 8:143760054-143760076 TCTGGGGCCCCAAAACACCATGG - Intergenic
1049720359 8:144112755-144112777 TGTCAGCTCCCAGAGCAGCAAGG - Intronic
1049723977 8:144137010-144137032 TATGGAGCCACAGAGCAGCAGGG + Intergenic
1049785651 8:144449436-144449458 GCAGGACCCCGAGAGCAGCATGG + Intergenic
1049821059 8:144633790-144633812 TCTCAGCCCCCAGAGCAGCCAGG + Intergenic
1050130436 9:2406633-2406655 TCTGGGCCCCCAAAAGTGCAGGG - Intergenic
1050204350 9:3181486-3181508 TCTCGGTGCCCAGAGCAGCGCGG - Intergenic
1051299871 9:15637138-15637160 TCTCAGCCTCCAGAGCAGCTAGG - Intronic
1051753113 9:20365451-20365473 TCTCAGCCCCCCGAGCAGCTGGG + Intronic
1053530322 9:38874809-38874831 TCTCGGCCTCCAGAGCAGGTGGG + Intergenic
1054202548 9:62099239-62099261 TCTCGGCCTCCAGAGCAGGTGGG + Intergenic
1054635814 9:67489126-67489148 TCTCGGCCTCCAGAGCAGGTGGG - Intergenic
1055047486 9:71944116-71944138 TCTCGGCCTCCTGAGCAGCTGGG - Intronic
1056524090 9:87426643-87426665 CCTCGGCCCCCTGAGTAGCAGGG - Intergenic
1057194859 9:93111295-93111317 CCTGGGCCCACAGAGCTGCTGGG + Intronic
1057320926 9:94011794-94011816 TCTGGGCCAAGAGAGCAGCATGG + Intergenic
1057919037 9:99081608-99081630 TCTGAGCCTCCTGAGCAGCTAGG - Intergenic
1059275718 9:113095319-113095341 TCTAGGTCCCCTGTGCAGCATGG + Intergenic
1059723122 9:116980891-116980913 TCTGCACACCCAGAGCAGCAAGG + Intronic
1060105254 9:120869146-120869168 TCAGGGCCCCCCGGGCGGCAGGG - Intronic
1060142779 9:121224932-121224954 TCTGAGCCTCCAGAGTAGCTGGG + Intronic
1061521701 9:131122100-131122122 TCTAGGCCCCCAGGACTGCAGGG - Exonic
1061617580 9:131790418-131790440 TGTGGGGTCCCAGAGCAGGAAGG - Intergenic
1061628476 9:131856417-131856439 TCTGGGGCTCCTCAGCAGCAAGG - Intergenic
1061733182 9:132632683-132632705 TCTGGCCTCAGAGAGCAGCAAGG + Intronic
1061870571 9:133518129-133518151 CCTGGGACCCCAGAGCAGGAGGG - Intronic
1062108177 9:134767015-134767037 CCTGGCCCCCCAGGACAGCAGGG + Exonic
1062625103 9:137438941-137438963 CCTGGGCCCCCAGTGCAGGCTGG - Intronic
1187819657 X:23273652-23273674 TATAGGACCCCAGAGCAGCACGG + Intergenic
1189485210 X:41425534-41425556 TCTCAGCCTCCAGAGTAGCAGGG + Intergenic
1189714887 X:43855069-43855091 TCTGGGCACCCAGACCAGGTAGG + Intronic
1190533855 X:51407373-51407395 TCTGGGGCCCCACAGCGGCCTGG - Exonic
1190864817 X:54375614-54375636 CCTTGGCCCCCGGAGCAGCTGGG + Intergenic
1190915902 X:54810954-54810976 TTTGGGCCCGCAGGGCATCAAGG + Exonic
1191728547 X:64308268-64308290 TCTCAGCCTCCAGAGCAGCTGGG + Intronic
1193103096 X:77637823-77637845 TCTCGGCCTCCAGAGTAGCTGGG - Intronic
1194767096 X:97854274-97854296 TCTGGGCCATTGGAGCAGCATGG + Intergenic
1194934052 X:99926075-99926097 TCTGAGCCTCCCGAGCAGCTCGG + Intergenic
1196180178 X:112680885-112680907 ACTGGGCCATCAGAGAAGCATGG - Intergenic
1197690508 X:129495469-129495491 CCTCGGCCTCCAGAGGAGCAAGG + Intronic
1198249981 X:134870520-134870542 GCTGGGCCCCAAGGGCTGCAAGG - Intergenic
1199744337 X:150762344-150762366 GCTCGGCCCCCGGAGCTGCAGGG + Intronic
1200002913 X:153071510-153071532 TCTTGGCCCTGAGGGCAGCATGG - Intergenic
1200004810 X:153078499-153078521 TCTTGGCCCTGAGGGCAGCATGG + Intergenic
1200228518 X:154432489-154432511 TCGGGGCCCAGAGAGCAGCAAGG + Intronic